Skip to main content

Table 1 Primer sequences used for the real-time quantittive PCR assays

From: Giardia duodenalis extracellular vesicles regulate the proinflammatory immune response in mouse macrophages in vitro via the MAPK, AKT and NF-κB pathways

Target Genebank number Primer sequences (5′ to 3′) Product size (bp) Primer length (nt) Cross intron length (nt) Primer site
IL-1β NM_008361 F: AGGAGAACCAAGCAACGACA 241 20 1545 582…601
R: CTCTGCTTGTGAGGTGCTGA 20 822…803
TNF-α NM_013693 F: GACGTGGAACTGGCAGAAGA 253 20 696 192…211
R: GGCTACAGGCTTGTCACTCG 20 446…427
IL-6 NC_000071 F: TGCCTTCTTGGGACTGATGC 216 20 1272 279…298
R: GCAAGTGCATCATCGTTGTTC 21 1765…1745
Actb NM_007393 F: GCCATGTACGTAGCCATCCA 240 20 455 391…410
R: ACGCACGATTTCCCTCTCAG 20 630…611
  1. Actb Beta-actin gene, F forward primer, IL interleukin, R reverse primer, TNF-α tumor necrosis factor alpha