Skip to main content

Table 1 Gene identification and primer sets of Babesia bovis genes of interest used for PCR and quantitative PCR

From: Differential expression of calcium-dependent protein kinase 4, tubulin tyrosine ligase, and methyltransferase by xanthurenic acid-induced Babesia bovis sexual stages

Gene identificationa Locus tag Forward primers (5′-3′) Reverse primers (5′-3′) Sizeb
cdpk4 (FL) BBOV_IV003210 CGCTGCTAAAGTGCAACATATCTTT CGTGTATGCATTTAGACACCTAGTTT 1707
cdpk4 (qPCR) BBOV_IV003210 GGCAGTATGTCGGACAAGGT CGAACGATCCTTTACCCAGA 193
mt (FL) BBOV_II003780 ATGACAGAACTTGCCCATGATCTC GAAACAGTCTGTAACCTGCGTTT 234
mt (qPCR) BBOV_II003780 TGACAGAACTTGCCCATGATC GGGGAAACATCTTCTTCATCTCA 102
ttl (FL) BBOV_III004540 ATGTTAAAGTCAGACATACCCATG TCTTTGAAAAATTGCAAGTGG 1242
ttl (qPCR) BBOV_III004540 TACACTGGGAATTGCACGAA GACGCCGTGGGTACTTTTTA 205
mapk (FL) BBOV_IV005520 CTCCATTGTACAAGTGCCCAAAGGAG CATGGCTTGTATATAATTTTGAGTGG 2203
mapk (qPCR) BBOV_IV005520 GCTTACGTAACCCGCCACTA ATATCAAAGGCACGGCAGAC 151
α-tubulin (FL) BBOV_III002820 GCCAACTTCAATCACTTCATTCCG GATGCTACGATTAAGTAAATGTTTTTC 1463
α-tubulin (qPCR) BBOV_III002820 CATGCTTGACAACGAGGCTA TGCGAGGGTAAGGTACCAAG 188
hap2 (qPCR) BBOV_III006770 AAAGCGTCTATGTAATCAA ACAGTTTTCTTCTCGTCA 165
  1. FL full length, qPCR quantitative PCR
  2. aInformation in parentheses refers to the purpose of PCR. Full-length primers used to amplify constructs used to build qRT-PCR standard curves
  3. bAmplicon size in base pairs