Skip to main content

Table 1 Hc-cbp-1 and Hc-cbp-2 recombinant protein expression and qPCR primers

From: Immune reactivity and host modulatory roles of two novel Haemonchus contortus cathepsin B-like proteases

Gene name Primer sequence
Bold and underlined: restriction sites
Recombinant protein expression (E) or qPCR (Q) primers
Hc-CBP-1 F:GAATTCTACGGAAGTACTTGGGGATTCTA
R:GCGGCCGCTAGTCTTCTAGTCACGTCGTT
E
Hc-CBP-2 F: GTCGACCAAGCGGATGTGCTCGCTGCTT
R: GCGGCCGCCCCTTGAACATGCCCGGCGA
E
Hc-cbp-1 F: ACAAGTTCTACGGCAAGGGA;
R: GCGGTGTGTTTGTAGACTCC
Q
Hc-cbp-2 F: GCGAGGACGCTTACGAATTA;
R: GGAGAAGTCCTCGTAAACAGTG
Q