A novel tetra-primer ARMS-PCR approach for the molecular karyotyping of chromosomal inversion 2Ru in the main malaria vectors Anopheles gambiae and Anopheles coluzzii

Table 1 Primers for the tetra-primer amplification refractory mutation system-PCR targeting the 2Ru tag single-nucleotide polymorphism 2R:31710303 in Anopheles coluzzii and Anopheles gambiae

Primer name	SNP target	2Ru genotype^a	Sequence 5′—3′^b, ^c
2Ru-universal-F	Non-allele-specific	Non-specific	GATGATACGGATTTGCTGGCAAG
2Ru-universal-R	Non-allele-specific	Non-specific	GGAATGTGTGAAAATGTGCCTCCACTG
2Ru-inverted	Allele T, 2R:31,710,303	2Ru	AGANGAAGAAAATGCTCTCGCNTTGA
2Ru-standard	Allele G, 2R:31,710,303	2R+^u	CAAGCAACTGGCGTCGAAGTNAAGTG

SNP Single-nucleotide polymorphism
^a2Ru/+^u, Heterozygote
^bNucleotides in italics and underlined within the internal primers identify intentionally inserted mismatches
^cAn ‘N’ denotes any nucleotide

ISSN: 1756-3305