Skip to main content

First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary



Recently, Hepatozoon canis infection has been detected among shepherd, hunting and stray dogs in the southern part of Hungary, which is considered to be free of Rhipicephalus sanguineus sensu lato and close to the border with Croatia. The aim of this study was to acquire information on the possibility that red foxes and/or golden jackals could play a role in the appearance and spread of H. canis in Hungary.


A conventional PCR was used to amplify a 666 bp long fragment of the Hepatozoon 18S rRNA gene from blood samples collected from 334 foxes shot in 231 locations in 16 counties and 15 golden jackals shot in 9 locations in two southwestern counties close to Croatia. A second PCR assay was performed in some of the samples positive by the first PCR to amplify a larger segment (approximately 1500 bp) of the 18S rRNA gene of Hepatozoon spp. for further phylogenetic analysis.


Hepatozoon infection was detected in canids shot in 30 locations and 9 counties. Altogether 26 foxes (8.0%, 95% CI: 5-11%) and 9 jackals (60%, 95% CI: 33-81%) were PCR positive. Hepatozoon canis sequences were obtained from 12 foxes and 7 jackals. DNA sequences from 16 animals were 99-100% similar to H. canis from Croatian foxes or dogs while two of the sequences were 99% similar to an Italian fox. Half (13/26) of the infected red foxes and all golden jackals were shot in the two southwestern counties.


This is the first report on molecular evidence of H. canis in red foxes (Vulpes vulpes) and golden jackals (Canis aureus) from Hungary, which is considered free from the tick vector of H. canis, R. sanguineus. Although no R. sanguineus sensu lato had been found on infected or non-infected wild canids, the detection of authochnous canine hepatozoonosis in Hungary might imply that the range of R. sanguineus sensu lato has reached this country.


Hepatozoon canis (Eucoccidiorida: Hepatozoidae) is an apicomplexan protozoan species, which is one of the most widespread tick-borne protozoa infecting domestic dogs and wild canids worldwide [1, 2]. The life cycle of H. canis requires two hosts, merogony occurs in an intermediate vertebrate host, and gametogony and sporogony take place in the haematophagous invertebrate definitive hosts. Rhipicephalus sanguineus, commonly referred to as the “kennel tick” or “brown dog tick”, is considered as the major vector of H. canis[3]. The role of this tick species, which is the definitive host, as a vector has been reinforced by the evidence of transstadial transmission from tick larvae to nymphs, in addition to transmission from the nymph to the adult stage [4]. Furthermore, transovarial transmission of H. canis could not be demonstrated [5].

The occurrence of canine hepatozoonosis is closely related to the geographical distribution of the definitive tick host, which is considered to be one of the most prevalent tick species worldwide [2, 6]. In Europe the geographical distribution of H. canis is restricted to the Mediterranean region, Balkan, and Iberian peninsulas where R. sanguineus sensu lato is frequent [7]. The vector tick becomes infected in the larval or nymph stages by ingesting blood of an intermediate host (dogs and wild canids) containing H. canis gamonts within leukocytes. The principal route of infection of dogs or other intermediate hosts is ingestion of a tick or parts of ticks containing mature oocysts, which is different from transmission of other arthropod-borne pathogens transmitted during blood-sucking by vectors (2,3). Salivary transfer of Hepatozoon spp. from the final hematophagenous vector host to the vertebrate intermediate host during the blood meal has not been demonstrated [1, 2]. The intermediate vertebrate hosts of H. canis can also be infected through vertical transmission of the parasite from the bitch to its offspring [8]. Animals from neonatal to adult age can be infected [9]. The infection could be subclinical with low levels of parasitaemia or could be manifested as a severe life-threatening disease with fever, lethargy, anaemia, cachexia, weight loss, and lymphadenopathy with high parasitaemia [10]. Severe co-infections of H. canis with other concomitant pathogens transmitted by R. sanguineus sensu lato or other vectors are especially frequent involving Babesia vogeli, Ehrlichia canis and Anaplasma platys[9, 11].

The potential of H. canis to infect a wide range of carnivorous species genetically close to domestic dogs is considerable. Hepatozoonosis has been detected where its tick vector is present in red foxes (Vulpes vulpes) in the following European countries: France [12], Portugal [13], Spain [14, 15], Croatia [16], and Italy [17]. Infected foxes were also described in Japan [18] and Israel [19]. Hepatozoon spp. infection have also been detected in other wild canids such as in the gray fox (Urocyon cinereoargenteus) [20], Pampas gray fox (Lycalopex gymnocercus) [21], golden jackal (Canis aureus) [22, 23], African wild dog (Lycaon pictus) [24], coyote (Canis latrans) [25, 26], spotted hyena (Crocuta crocuta) [27], cheetah (Acinonyx jubatus), leopard (Panthera iridus) and lion (Panthera leo) [28].

Recently, H. canis infection has been detected among shepherd, hunting and stray dogs in the southern part of Hungary close to the border with Croatia, which is considered to be free of R. sanguineus sensu lato [29]. The aim of this study was to acquire information on the possibility that red foxes and/or golden jackals could play a role in the appearance and spread of H. canis in Hungary.


Collection of samples

The blood samples originated from 334 red foxes (V. vulpes) representing 231 locations of all seven Hungarian regions (Figure 1). The foxes were shot and the carcasses were sent to the National Food Safety Office, Veterinary Diagnostic Directorate, Budapest as part of a control program on oral immunization of foxes against rabies. Blood samples were also collected from 15 golden jackals (C. aureus) shot in nine locations of two southwestern counties close to Croatia belonging to the Southern Transdanubia region (Figure 1). After opening the thoracic cavity of the jackals and foxes, blood was collected from the heart and stored at -18°C. Ticks were searched for only on golden jackals. The study was carried out by observing the hunting regulations of the Hungarian Ministry of Agriculture and Rural Development (No. 79/2004.[V.4.] FVM).

Figure 1
figure 1

Geographical locations where red foxes and golden jackals were sampled and H. canis infected canids occurred in Hungary.

DNA isolation, amplification and sequencing

DNA was extracted from each blood sample using the QIAamp DNA Mini Kit (QIAgen GmbH., Hilden, Germany) following the “Blood and body fluid” protocol instructions by the manufacturer.

A conventional PCR modified from Inokuma et al. [30] was used to amplify a 666 bp long fragment of the Hepatozoon 18S rRNA gene with primers HepF (5’-ATA CAT GAG CAA AAT CTC AAC-3’) and HepR (5’-CTT ATT ATT CCA TGC TGC AG-3’). Two and a half μl of extracted DNA were added to 22.5 μl of reaction mixture containing 1.0 U HotStar Taq DNA Plus Polymerase (5 U/μl), 0.5 μl dNTPs (10 mM), 0.2 μl of each primer (50 μM), 2.5 μl of 10× Coral Load PCR buffer (15 mM MgCl2 included), 1 μl MgCl2 (25 mM) and 17.9 μl DW.

Amplification was performed in a T-personal thermal cycler (Biometra, Goettingen, Germany). An initial denaturation step at 95°C for 5 min was followed by 35 cycles of denaturation at 95°C for 40 s, annealing at 57°C for 40 s and extension at 72°C for 60 s. Final extension was performed at 72°C for 7 min then held at 11°C. DNA of Hepatozoon sp. found in a rodent served as positive control. PCR products were visualized under ultra-violet light on 1.5% agarose gel (100 V, 30 min) stained with ethidium–bromide, and were sized by comparison with Gene Ruler 100-bp DNA Ladder (Thermo Fisher Scientific Inc., Waltham, Massachusetts, USA) as molecular marker.

A second PCR assay was performed in some of the samples which were previously positive by the first PCR in order to amplify a larger segment (approximately 1500 bp) of the 18S rRNA gene of Hepatozoon spp. for further phylogenetic analysis. This assay used primers HAM-1 F GCCAGTAGTCATATGCTTGTC and HPF-2R GACTTCTCCTTCGTCTAAG [31]. The amplification conditions for this reaction were: 95°C, 5 min; (34× [95°C 20 sec, 56°C, 30 sec, 72°, 90 sec]; 72°C, 5 min).

Selected PCR products were purified and sequenced at Macrogen Inc. (Seoul, South Korea) or at the Hebrew University (Jerusalem, Israel). Sequences were determined in both directions (using the same primers individually as for the PCR). Sequences were compared with 18S rRNA gene sequences of Hepatozoon species available in GenBank.

Phylogenetic analysis

A phylogenetic analysis, which included DNA sequences from the blood of jackals and foxes from the study, was carried out to compare these sequences to Hepatozoon spp. sequences that had previously been deposited in GenBank. Sequences were analyzed using the MEGA version 5.1 ( and phylogenetic trees were constructed by the Maximum-Likelihood algorithms using the Tamura-3-Parameter model. Bootstrap replicates were performed to estimate the node reliability, and values were obtained from 500 randomly selected samples of the aligned sequence data.

Statistical analysis

Confidence intervals were calculated by the Sterne method [32]. All statistical analyses and mapping were performed using the R-environment [33].

Results and discussion

Hepatozoon infection was detected in both red foxes and golden jackals shot in 30 locations in 9 counties (Figure 1). Altogether 26 foxes and 9 jackals were PCR positive of which half of the infected red foxes and all golden jackals were shot in two southwestern counties close to Croatia. The other infected red foxes, except for two animals, were shot close to the borders with Austria and Slovenia, Serbia, Romania and Ukraine. The observed prevalence of H. canis was 8% (95% CI: 5-11%) in red foxes and 60% (95% CI: 33-81%) in golden jackals. Seven out of 15 golden jackals were infested with Ixodes ricinus, Dermacentor reticulatus or Haemaphysalis concinna ticks.

Hepatozoon canis sequences were obtained from 14 red foxes [GenBank: KC886720, KC886722-28, KF322141-144, KJ572978-79], and 9 golden jackals [GenBank: KC886721, KC886729-33, KJ572975-77]. BLAST search revealed that 16 out of 19 sequences obtained in the study were 99-100% similar to H. canis from Croatian foxes or dogs while two of sequences [GenBank: KC886722 from a fox and KC886729 from a jackal] were 99% similar to a sequence from an Italian fox [GenBank: GU371447]. A 1545 bp sequence of H. canis amplified from a jackal using the HAM-1 F and HPF-2R and comprising almost all of the 18S rRNA gene was submitted to GenBank [KJ634654] and found to be 99% similar to H. canis from a Spanish fox [GenBank: AY150067].

A phylogenetic tree constructed by comparison of 660 bp sequences from the 18S rRNA gene (Figure 2) indicated that H. canis sequences from the Hungarian jackals and red foxes clustered together with other H. canis sequences from dogs, jackals and foxes from other countries in Europe and from Brazil and away from Hepatozoon americanum and Hepatozoon felis sequences. However, sequences of H. canis from Hungarian jackals clustered separately from those of Hungarian foxes, which grouped together with a sequence from an Austrian jackal.

Figure 2
figure 2

Maximum likelihood 18S tree; A Maximum likelihood tree phylogram comparing 660 bp 18S Hepatozoon DNA sequences from Hungarian golden jackals and red foxes to other related Hepatozoon spp. DNA sequences from GenBank. The GenBank accession numbers, Hepatozoon species, host species and country of origin from which the sequences were derived are included for each sequence. New sequences derived from the present study are designated as being from Hungary.

A second phylogenetic tree compared 1382 bp sequences of the Hepatozoon 18S rRNA gene and included the long sequence of the 18S rRNA gene amplified from a Hungarian jackal [GenBank: KJ634654] (Figure 3). This analysis found that all H. canis sequences clustered separately from H. felis; however, there were separate clusters within H. canis. The H. canis sequence from the Hungarian jackal clustered close to H. canis from foxes from Brazil and Spain.

Figure 3
figure 3

Maximum likelihood 18S tree; A Maximum likelihood tree phylogram comparing 1382 bp 18S DNA sequences of Hepatozoon canis and Hepatozoon felis to H. canis from a Hungarian jackal. The GenBank accession numbers, Hepatozoon species, host species and country of origin from which the sequences were derived are included for each sequence.

Hepatozoon canis has been reported previously outside the Mediterranean areas of Europe in imported dogs [34, 35]. However, in the last few years, H. canis infection of local wild canids was reported for the first time from Slovakia [36], Poland [37] and Austria [23] which were previously considered non-endemic for this parasite due to the absence of R. sanguineus sensu lato in these areas. We assume that if these carnivorous species can be sylvatic reservoirs of this apicomplexan parasite they may play a role in the appearance of canine hepatozoonosis in Hungary. Our findings confirm this hypothesis because many red foxes and golden jackals were found to be infected with H. canis. Based on the high percentage (60%, 9/15) of the infected golden jackals in the two southern counties neighbouring with Croatia we suppose that they might have brought the parasite to Hungary from that country where dogs and red foxes are infected with H. canis and R. sanguineus sensu lato is widespread [16, 38]. It is unknown how long H. canis has been present in Hungary. It is possible that this protozoan parasite arrived in the last decade of the twentieth century when golden jackals started to spread from the Balkan toward Hungary [39], especially from Croatia, and settled in the southwestern part of Hungary [40]. The parasite might have also arrived to the country by infected red foxes from the neighbouring country. In other countries, foxes seem to be very susceptible hosts for this infection, for instance, the prevalence in Portugal was found to be 48% (143/301) in one study [13] and 76% in a second survey [41], in Croatia [16] it was 23% and in Israel, an ELISA survey found that 24% of the foxes were seropositive [19]. However, more data should be collected to answer whether the golden jackal could be more susceptible than the red fox.

Concerning the origin of the parasites detected in Hungary, our hypothesis that this infection came from Croatia was strengthened by the PCR detection of H. canis in 13 red foxes and 9 golden jackals shot in the counties neighbouring Croatia. The origin of the local H. canis was further substantiated by sequencing H. canis of 12 red foxes and 7 golden jackals. Except for three samples, all others were 99-100% similar to H. canis from Croatian red foxes or dogs.

The question is where and how these wild animals became infected because R. sanguineus sensu lato has not been found in Hungary except for in an imported case [42]. It can be assumed that some golden jackals and/or red foxes might have become infected in Croatia by ingesting R. sanguineus ticks containing mature oocysts of H. canis or by preying on other animals infested with this vector harbouring infective stages of the parasite. Vertical transmission of the parasite [8] may also help to explain why so many animals were found to be PCR positive. The other question that arose in this study and remains without answer is whether the red foxes shot close to the borders with 5 other neighbouring countries became infected in Hungary or not.

There has been no explanation on how 33 local shepherd, hunting and stray dogs acquired H. canis[29]. We think that so many dogs could not be infected by ingesting infected ticks that arrived with golden jackals, red foxes or rodents from the neighbouring countries. Although no R. sanguineus sensu lato has been found on infected and non-infected domestic and wild animals, the detection of autochthonous canine hepatozoonosis in Hungary might imply that the range of R. sanguineus sensu lato has reached this country. The vector tick might be present at least during the hot summer months suitable for this tick species to establish an endemic focus. In this case the question is whether R. sanguineus sensu lato can survive year round and reproduce in Hungary. Further studies should be conducted in the southern part of Hungary in order to answer this question. Another possible explanation is also available. Although the major vector of H. canis is R. sanguineus sensu lato, the invertebrate host range of this parasite has not yet been fully elucidated. Taking into account that the same tick species can infest dogs [29] and red foxes [43] in Hungary and H. concinna nymphs removed from a PCR-negative dog were found positive for H. canis[29], the transmission of H. canis by other tick species cannot be excluded. In Japan, potential and additional tick vectors, Haemaphysalis longicornis and Haemaphysalis flava were found [44]. Pfister et al. [45] reported that the hedgehog tick, Ixodes hexagonus could be a vector of H. canis. Forlano et al. [46] experimentally proved that Amblyomma ovale transmitted the parasite in Brazil. Furthermore, Italian and Austrian scientists suggested the potential role of I. ricinus as a vector of H. canis among domestic and wild canids [17, 23]. However, the results of a later study indicated that I. ricinus ingested H. canis gamonts during the blood meal but further development and sporogony did not occur suggesting that I. ricinus does not act as a vector [47]. Hepatozoon canis oocysts have also been found in Rhipicephalus microplus (formerly Boophilus microplus) but the vector role of this tick species has not been confirmed [48].

Although the first analysis (Figure 2) showed that H. canis from Hungarian foxes clustered separately from Hungarian jackals, they did cluster together with H. canis from a jackal from neighbouring Austria. Overall, H. canis 18S rRNA sequences from different locations and continents including Taiwan in Asia, Brazil in South America, Spain and central European countries, and from different canine hosts such as the domestic dog, golden jackal and red fox, clustered without obvious geographical and host-related division patterns. This may suggest that H. canis is a ubiquitous canine parasite which crosses between canine host species and is also transferred successfully between geographic regions by the movement and importation of these hosts.


To our best knowledge, this is the first report on detection of H. canis in red foxes and golden jackals in Hungary. Further investigation should elucidate the routes of H. canis transmission amongst wild carnivores and between them and local dogs. Besides H. canis, ectoparasite vectors can also transmit several other pathogens from wild canids to dogs. Therefore, the increased activity of vector species due to the climate changes with increasing urbanization and the more common contact between domestic and wild animals stresses the need to study the vector-borne pathogens of red foxes, golden jackals and other carnivore species.


  1. Smith TG: The genus Hepatozoon (Apicomplexa: Adeleina). J Parasitol. 1996, 82: 565-585. 10.2307/3283781.

    CAS  Article  PubMed  Google Scholar 

  2. Baneth G: Perspectives on canine and feline hepatozoonosis. Vet Parasitol. 2011, 181: 3-11. 10.1016/j.vetpar.2011.04.015.

    Article  PubMed  Google Scholar 

  3. Baneth G, Samish M, Shkap V: Life cycle of Hepatozoon canis (Apicomplexa: Adeleorina: Hepatozoidae) in the tick Rhipicephalus sanguineus and domestic dog (Canis familiaris). J Parasitol. 2007, 93: 283-299. 10.1645/GE-494R.1.

    Article  PubMed  Google Scholar 

  4. Giannelli A, Ramos RA, Di Paola G, Mencke N, Dantas-Torres F, Baneth G, Otranto D: Transstadial transmission of Hepatozoon canis from larvae to nymphs of Rhipicephalus sanguineus. Vet Parasitol. 2013, 196 (1–2): 1-5.

    Article  PubMed  Google Scholar 

  5. Baneth G, Samish M, Alekseev E, Aroch I, Shkap V: Transmission of Hepatozoon canis to dogs by naturally-fed or percutaneously-injected Rhipicephalus sanguineus ticks. J Parasitol. 2001, 187: 606-611.

    Article  Google Scholar 

  6. Dantas-Torres F: Biology and ecology of the brown dog tick, Rhipicephalus sanguineus. Parasit Vectors. 2010, 3: 26-10.1186/1756-3305-3-26.

    PubMed Central  Article  PubMed  Google Scholar 

  7. Estrada-Peña A, Jaenson TGT, Farkas R, Pascucci I: Maps of reported occurrence of ticks. Ticks and Tick-Borne Diseases: Geographical Distribution and Control Strategies in the Euro-Asia Region. Edited by: Salman M, Tarres-Call J. 2013, Wallingford, UK: CABI (CAB International), 89-97.

    Chapter  Google Scholar 

  8. Murata T, Inoue M, Tateyama S, Taura Y, Nakama S: Vertical transmission of Hepatozoon canis in dogs. J Vet Med Sci. 1993, 55: 867-868. 10.1292/jvms.55.867.

    CAS  Article  PubMed  Google Scholar 

  9. Otranto D, Dantas-Torres F, Weigl S, Latrofa MS, Stanneck D, Decaprariis D, Capelli G, Baneth G: Diagnosis of Hepatozoon canis in young dogs by cytology and PCR. Parasit Vectors. 2011, 4: 55-10.1186/1756-3305-4-55.

    PubMed Central  Article  PubMed  Google Scholar 

  10. Baneth G, Weigler B: Retrospective case–control study of hepatozoonosis in dogs in Israel. J Vet Intern Med. 1997, 11: 365-370. 10.1111/j.1939-1676.1997.tb00482.x.

    CAS  Article  PubMed  Google Scholar 

  11. Baneth G: Hepatozoonosis. Guide to vector borne diseases of pets. Edited by: Beugnet F, Beugnet F. 2013, Lyon: MERIAL, 281-291.

    Google Scholar 

  12. Rioux JA, Golvan YJ, Honin R: Mixed Hepatozoon canis and Leishmania canis infection in a dog in the Sets area, France. Ann. Parasitol Hum Comp. 1964, 39: 131-135.

    CAS  Google Scholar 

  13. Conceicão-Silva FM, Abranches P, Silva-Pereira MC, Janz JG: Hepatozoonosis in foxes from Portugal. J Wildl Dis. 1988, 24: 344-347. 10.7589/0090-3558-24.2.344.

    Article  PubMed  Google Scholar 

  14. Criado-Fornelio A, Martinez-Marcos A, Buling-Sarana A, Barba-Carretero JC: Molecular studies on Babesia, Theileria and Hepatozoon in southern Europe. Part I. Epizootiological aspects. Vet Parasitol. 2003, 113: 189-201. 10.1016/S0304-4017(03)00078-5.

    CAS  Article  PubMed  Google Scholar 

  15. Gimenez C, Casado N, Criado-Fornelio A, de Muguel FA, Dominguez-Peñafiel G: A molecular survey of Piroplasmida and Hepatozoon isolated from domestic and wild animals in Burgos (northern Spain). Vet Parasitol. 2009, 162: 147-150. 10.1016/j.vetpar.2009.02.021.

    CAS  Article  PubMed  Google Scholar 

  16. Dezdek D, Vojta L, Curković S, Lipej Z, Mihaljević Z, Cvetnić Z, Beck R: Molecular detection of Theileria annae and Hepatozoon canis in foxes (Vulpes vulpes) in Croatia. Vet Parasitol. 2010, 172: 333-336. 10.1016/j.vetpar.2010.05.022.

    Article  PubMed  Google Scholar 

  17. Gabrielli S, Kumlien S, Calderini P, Brozzi A, Iori A, Cancrini G: The first report of Hepatozoon canis identified in Vulpes vulpes and ticks from Italy. Vector Borne Zoonotic Dis. 2010, 10: 855-859. 10.1089/vbz.2009.0182.

    Article  PubMed  Google Scholar 

  18. Maede Y, Ohsugi T: Hepatozoon infection in a wild fox (Vulpes vulpes schrencki Kishida) in Japan. Japan J Vet Sci. 1982, 44: 137-142. 10.1292/jvms1939.44.137.

    CAS  Article  Google Scholar 

  19. Fishman Z, Gonen L, Harrus S, Strauss-Ayali D, King R, Baneth G: A serosurvey of Hepatozoon canis and Ehrlichia canis antibodies in wild red foxes (Vulpes vulpes) from Israel. Vet Parasitol. 2004, 119: 21-26. 10.1016/j.vetpar.2003.08.012.

    Article  PubMed  Google Scholar 

  20. Allen KE, Yabsley MJ, Johnson EM, Reichard MV, Panciera RJ, Ewing SA, Little SE: Novel Hepatozoon in vertebrates from the southern United States. J Parasitol. 2011, 97: 648-653. 10.1645/GE-2672.1.

    Article  PubMed  Google Scholar 

  21. Giannitti F, Diab SS, Uzal FA, Fresneda K, Rossi D, Talmi-Frank D, Baneth G: Infection with a Hepatozoon sp. closely related to Hepatozoon felis in a wild Pampas gray fox (Lycalopex -Pseudalopex -gymnocercus) co-infected with canine distemper virus. Vet Parasitol. 2012, 186: 497-502. 10.1016/j.vetpar.2011.11.006.

    Article  PubMed  Google Scholar 

  22. Shamir M, Yakobson B, Baneth G, King R, Dar-Verker S, Markovics A, Aroch L: Antibodies to selected canine pathogens and infestation with intestinal helminths in golden jackals (Canis aureus) in Israel. Vet J. 2001, 162: 66-72. 10.1053/tvjl.2000.0572.

    CAS  Article  PubMed  Google Scholar 

  23. Duscher G, Kübber-Heiss A, Richter B, Suchentrunk F: A golden jackal (Canis aureus) from Austria bearing Hepatozoon canis – import due to immigration into a non-endemic area?. Ticks Tick Borne Dis. 2013, 4: 133-137. 10.1016/j.ttbdis.2012.10.040.

    Article  PubMed  Google Scholar 

  24. Van Heerden J, Mills MG, Van Vuuren MJ, Kelly PJ, Dreyer MJ: An investigation into the health status and diseases of wild dogs (Lycaon pictus) in the Kruger National Park. J S Afr Vet Assoc. 1995, 66: 18-27.

    CAS  PubMed  Google Scholar 

  25. Davis DS, Robinson RM, Craig TM: Naturally occurring hepatozoonosis in a coyote. J Wildl Dis. 1978, 14: 244-246. 10.7589/0090-3558-14.2.244.

    CAS  Article  PubMed  Google Scholar 

  26. Starkey LA, Panciera RJ, Paras K, Allen KE, Reiskind MH, Reichard MV, Johnson EM, Little SE: Genetic diversity of Hepatozoon spp. in coyotes from the south central United States. J Parasitol. 2013, 99: 375-378. 10.1645/GE-3104.1.

    Article  PubMed  Google Scholar 

  27. East ML, Wibbelt G, Lieckfeldt D, Ludwig A, Goller K, Wilhelm K, Schares G, Thierer D, Hofer H: A Hepatozoon species genetically distinct from H. canis infecting spotted hyenas in the Serengeti ecosystem, Tanzania. J Wildl Dis. 2008, 44: 45-52. 10.7589/0090-3558-44.1.45.

    CAS  Article  PubMed  Google Scholar 

  28. McCully RM, Basson PA, Bigalke RD, de Vos V, Young E: Observation on naturally acquired hepatozoonosis of wild carnivores and dogs in the Republic of South Africa. Onderstepoort J Vet Res. 1975, 42: 117-133.

    CAS  PubMed  Google Scholar 

  29. Hornok S, Tánczos B, Fernández De Mera IG, de la Fuente J, Hofmann- Lehmann R, Farkas R: High prevalence of Hepatozoon-infection among shepherd dogs in a region considered to be free of Rhipicephalus sanguineus. Vet Parasitol. 2013, 196: 189-193. 10.1016/j.vetpar.2013.02.009.

    CAS  Article  PubMed  Google Scholar 

  30. Inokuma H, Okuda M, Ohno K, Shimoda K, Onishi T: Analysis of the 18S rRNA gene sequence of a Hepatozoon detected in two Japanese dogs. Vet Parasitol. 2002, 106: 265-271. 10.1016/S0304-4017(02)00065-1.

    CAS  Article  PubMed  Google Scholar 

  31. Criado-Fornelio A, Ruas JL, Casado N, Farias NA, Soares MP, Müller G, Brumt JG, Berne ME, Buling-Saraña A, Barba-Carretero JC: New molecular data on mammalian Hepatozoon species (Apicomplexa: Adeleorina) from Brazil and Spain. J Parasitol. 2006, 92: 93-99. 10.1645/GE-464R.1.

    CAS  Article  PubMed  Google Scholar 

  32. Sterne TE: Some remarks on confidence or fiducial limits. Biometrika. 1954, 41: 275-278.

    Google Scholar 

  33. R Core Team R: A language and environment for statistical computing. 2014, Vienna, Austria: R Foundation for Statistical Computing,,

    Google Scholar 

  34. Fischer S, Hartmann K, Gothe R: Hepatozoon canis: eine importierte parasitare Infektion bei Hunden. Tier Prax. 1994, 22: 172-180.

    CAS  Google Scholar 

  35. Holland M: Emerging diseases in Northern Europe. J Small Anim Pract. 2001, 42: 205-206.

    CAS  Article  PubMed  Google Scholar 

  36. Majláthová V, Hurníková Z, Majláth I, Petko B: Hepatozoon canis infection in Slovakia: imported or autochthonous?. Vector Borne Zoonotic Dis. 2007, 7: 199-202. 10.1089/vbz.2006.0598.

    Article  PubMed  Google Scholar 

  37. Karbowiak G, Majláthová V, Hapunik J, Pet’ko B, Wita I: Apicomplexan parasites of red foxes (Vulpes vulpes) in northeastern Poland. Acta Parasitologica. 2010, 55: 210-214. 10.2478/s11686-010-0030-6.

    Article  Google Scholar 

  38. Vojta L, Mrljak VC, Urkovic’ S, Ziviˇcnjak T, Marinculi’ CA, Beck R: Molecular epizootiology of canine hepatozoonosis in Croatia. Int J Parasitol. 2009, 39: 1129-1136. 10.1016/j.ijpara.2009.02.007.

    CAS  Article  PubMed  Google Scholar 

  39. Arnold J, Humer A, Heltai A, Murariu D, Spassov N, Hackländer K: Current status and distribution of golden jackals Canis aureus in Europe. Review. Mammal Rev. 2012, 42: 1-11. 10.1111/j.1365-2907.2011.00185.x.

    Article  Google Scholar 

  40. Szabó L, Heltai M, Szűcs E, Lanszki J, Lehoczki R: Expansion range of the golden jackal in Hungary between 1997 and 2006. Mammalia. 2009, 73: 307-311.

    Article  Google Scholar 

  41. Cardoso L, Cortes HC, Eyal O, Reis A, Lopes AP, Vila-Viçosa MJ, Rodrigues PA, Baneth G: Molecular and histopathological detection of Hepatozoon canis in red foxes (Vulpes vulpes) from Portugal. Parasit Vectors. 2014, 7: 113-10.1186/1756-3305-7-113.

    PubMed Central  Article  PubMed  Google Scholar 

  42. Hornok S, Farkas R: First autochthonous infestation of dogs with Rhipicephalus sanguineus (Acari: Ixodidae) in Hungary: case report and review of current knowledge on this tick species [in Hungarian with English abstract]. Magy Allatorv Lap. 2005, 127: 623-629.

    Google Scholar 

  43. Sréter T, Széll Z, Varga I: Ectoparasite infestations of red foxes (Vulpes vulpes) in Hungary. Vet Parasitol. 2003, 115: 349-354. 10.1016/S0304-4017(03)00216-4.

    Article  PubMed  Google Scholar 

  44. Murata T, Inoue M, Taura Y, Nakama S, Abe H, Fujisaki K: Detection of Hepatozoon canis oocyst from ticks collected from the infected dogs. J Vet Med Sci. 1995, 57: 111-112. 10.1292/jvms.57.111.

    CAS  Article  PubMed  Google Scholar 

  45. Pfister K, Beelitz P, Beck W: Parasitologische Diagnostik. Klinische Labordiagnositik in der Tiermedizin. Edited by: Kraft W, Dürr U. 2005, New York: Schattauer, Stuttgart, 371-428.

    Google Scholar 

  46. Forlano M, Scofield A, Elisei C, Fernandes KR, Pereira AM, Velho PB, Rubini AS, Almosny NRP: Diagnosis of Hepatozoon spp. in Amblyomma ovale and its experimental transmission in domestic dogs in Brazil. Vet Parasitol. 2005, 134: 1-7. 10.1016/j.vetpar.2005.05.066.

    CAS  Article  PubMed  Google Scholar 

  47. Giannelli A, Ramosa RFN, Dantas-Torresa F, Mencke N, Baneth G, Otranto D: Experimental evidence against transmission of Hepatozoon canis by Ixodes ricinus. Ticks Tick Borne Dis. 2013, 4: 391-394. 10.1016/j.ttbdis.2013.03.001.

    Article  PubMed  Google Scholar 

  48. de Miranda RL, de Castro JR, Olegário MM, Beletti ME, Mundim AV, O’Dwyer LH, Eyal O, Talmi-Frank D, Cury MC, Baneth G: Oocysts of Hepatozoon canis in Rhipicephalus (Boophilus) microplus collected from a naturally infected dog. Vet Parasitol. 2011, 177: 392-396. 10.1016/j.vetpar.2011.01.044.

    Article  PubMed  Google Scholar 

Download references


The authors are grateful to Mónika Gyurkovszky (Faculty of Veterinary Science, Budapest) for helping in laboratory work. The authors thank the European Cooperation in Science and Technology (COST) action TD1303 EURNEGVEC.

Author information



Corresponding author

Correspondence to Róbert Farkas.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

Designed the study: RF, SH, GB. Collected samples: RF, SH, ÁH. Processed samples: RF, NT, ÁH. Performed PCR: NT, YNB. Analyzed sequences: RF, GB, NT, YNB. Analyzed the data: NS. Wrote the paper: RF, GB. All authors read and approved the final version of the manuscript.

Authors’ original submitted files for images

Below are the links to the authors’ original submitted files for images.

Authors’ original file for figure 1

Authors’ original file for figure 2

Authors’ original file for figure 3

Rights and permissions

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Farkas, R., Solymosi, N., Takács, N. et al. First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites Vectors 7, 303 (2014).

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI:


  • Fox
  • Golden jackal
  • Hepatozoon canis
  • Hungary