Skip to main content

Table 1 The four pairs of specific primers used to amplify sodium channel gene mutations detected in Cx. p. quinquefasciatus

From: Sodium channel point mutations associated with pyrethroid resistance in Chinese strains of Culex pipiens quinquefasciatus (Diptera: Culicidae)

Primers 5′ → 3′Sequence length (bp)
Cx-M1 GATGATCATGCCATCCACGC 548
CTTCCTCACATTGGCCAGCA
Cx-M2 CGACAGTCGAATCTACCGAGGTG 995
CTTCTCCTTGTTGTTGTCGTCG
Cx-M3 GAGCTGTTCATCACGCTCTG 689
GCCGACAAACTCGAGGAACC
Cx-M4 GCCGGATAACGACAAGGGTT 661
GGGCTCGTTATCACAGGCAT