Sodium channel point mutations associated with pyrethroid resistance in Chinese strains of Culex pipiens quinquefasciatus (Diptera: Culicidae)
https://doi.org/10.1186/1756-3305-7-369
© Zhao et al.; licensee BioMed Central Ltd. 2014
Received: 30 May 2014
Accepted: 1 August 2014
Published: 15 August 2014
Abstract
Background
Pesticide resistance due to sodium channel point mutations has been well documented in many mosquito species.
Methods
We tested the resistance of six, wild, Chinese populations of the mosquito Culex pipiens quinquefasciatus to deltamethrin and cyhalothrin. The full length of the sodium channel gene was cloned and sequenced from a pooled sample of mosquitoes from each population.
Results
Seven amino acid alterations were found (V250M, R436K, M943V, I973T, L1035F, L1035S and E1901D). Correlation between the frequencies of these mutations and the level of pesticide resistance (LC50) associated with them indicates that those at position L1035 (corresponding to position L1014F in the house fly, Musca domestica; GenBank Accession No.: X96668) are associated with resistance to deltamethrin and cyhalothrin. The frequency of the L1035F mutation was significantly correlated with resistance to deltamethrin (R2 = 0.536, P = 0.049) and cyhalothrin (R2 = 0.626, P = 0.030), and the combined frequency of the L1035F and L1035S mutations was significantly correlated with resistance to both deltamethrin (R2 = 0.661, P = 0.025), and cyhalothrin (R2 = 0.803, P = 0.008). None of the other mutations were correlated with either deltamethrin or cyhalothrin resistance. Interestingly, an HWE test indicated significant linkage between the M943V and I973T mutations (P < 0.01), but further research is required to determine the biological significance of this linkage.
Conclusions
Identifying these mutations may be of practical benefit to the development of pesticide resistance management programs.
Keywords
Background
Cx. pipiens quinquefasciatus is the predominant mosquito species in urban environments in southern China. This species is a major biting nuisance, particularly in urban areas where it thrives in wet pit-latrines, polluted puddles, gutters, and blocked open drains. It is also a major vector of filariasis [1], West Nile virus (WNV) [2], St. Louis encephalitis virus (SLEV) [3], and Rift Valley Fever virus (RVFV) [4, 5]. Cx. p. quinquefasciatus is one of the most studied mosquito species with respect to insecticide resistance.
“Pyrethroid” is the general term for a group of synthetic chemicals based on the structure of natural pyrethrins derived from Chrysanthemum flowers [6]. Pyrethroids are now becoming the most commonly used insecticides for mosquito control [7]. Compared to other insecticides, most pyrethroids are nontoxic to mammals but have a high knockdown effect on insects. Unfortunately, the extensive use of pyrethroids has led to the widespread development of resistance to this group of pesticides in mosquito populations [8–10]. The increase in resistance can be both large and rapid; one study reported an approximately 298-fold increase in resistance in Cx. p. quinquefasciatus after 10 generations of exposure to deltamethrin [11].
Modification of the active site of the sodium channel is an important mechanism involved in pyrethroid resistance [12, 13]. Voltage-gated sodium channels are integral transmembrane proteins responsible for the rapidly rising phase of action potentials that is critical for electrical signaling in most excitable cells. Because of their crucial role in membrane excitability, sodium channels are the target of a great variety of neurotoxins, including insecticidal pyrethrins [14]. Pyrethroid insecticides bind to insect para-sodium channels locking them in an open state thereby disrupting neuronal signaling resulting in paralysis and death.
Point mutations in the para-sodium channel gene that make sodium channel insensitive to pyrethrins are an important mechanism of resistance to pyrethroid insecticides in various insect species [15–22]. The most common mutation is the substitution of leucine by phenylalanine at residue L1014, commonly referred to as the kdr (knockdown resistance) mutation. Resistance conferred by the L1014F mutation was first described in the Italian housefly with respect to DDT [23] and subsequently named knockdown resistance [24]. Variants of this mutation such as L1014S, L1014H, L1014W and L1014C have also been reported [25–28]. Another mutation, M918T, has also been found in many insects [29–31]. This mutation and the L1014F mutation often occur together in which case they confer what has been called “super-kdr resistance”.
One approach to investigating pesticide resistance in mosquitoes is to first identify mutations that could potentially confer resistance and then attempt to correlate the frequency of these with actual pesticide resistance. Through a combination of insecticide bioassays and molecular techniques, we identified mutations associated with resistance to deltamethrin and cyhalothrin in six wild Chinese populations of Cx. p. quinquefasciatus and assessed the similarity between these and previously documented mutations in the sodium channel gene. Knowledge of these mutations may have practical benefits for further research on pesticide resistance in mosquitoes and for designing resistance management programs.
Methods
Mosquito strains
The distribution of collecting sites of Cx. p. quinquefasciat us. ①-⑥ indicated the six field strains of Cx. p. quinquefasciat us in China. RR was resistance ratio to deltamethrin, and the percentages were mutation frequencies of L1035F.
Bioassay
Bioassays were conducted by putting thirty late 3rd or early 4th instar larvae into pans containing 199 ml water and 1 ml of either deltamethrin or cyhalothrin. The insecticides were added to each pan using an automatic pipette according to the methods specified by the WHO [32]. Larval mortality was recorded 24 h after each treatment. No food was offered to the larvae during bioassays. Larvae were kept in a laboratory under the following conditions: 14 L:10D photoperiod, 75% relative humidity and a temperature of 26 ± 1°C during bioassays. Bioassays of each insecticide were repeated three times. Statistical analyses were performed using SPSS software version 13.
Extraction of RNA, cDNA synthesis and PCR amplification
Schematic diagram of amplification of the sodium channel gene of Cx. p. quinquefasciatus . The complete gene sequence was 6450 bp, and the gene’s six sections are indicated by arrows.
Cloning and sequencing of PCR products
The four pairs of specific primers used to amplify sodium channel gene mutations detected in Cx. p. quinquefasciatus
Primers | 5′ → 3′Sequence | length (bp) |
---|---|---|
Cx-M1 | GATGATCATGCCATCCACGC | 548 |
CTTCCTCACATTGGCCAGCA | ||
Cx-M2 | CGACAGTCGAATCTACCGAGGTG | 995 |
CTTCTCCTTGTTGTTGTCGTCG | ||
Cx-M3 | GAGCTGTTCATCACGCTCTG | 689 |
GCCGACAAACTCGAGGAACC | ||
Cx-M4 | GCCGGATAACGACAAGGGTT | 661 |
GGGCTCGTTATCACAGGCAT |
Analysis of genetic linkage between mutations
We use the GENEPOP software package to estimate conformity to the HWE and genetic linkage between mutations.
Correlation of pesticide resistance with the frequencies of different mutations
The resistance (LC50) of the six populations to deltamethrin and cyhalothrin was determined by bioassay and the allele frequencies of the various mutations determined by gene-specific amplification and sequencing as described above. The LC50 of a laboratory strain that had not been exposed to either pesticide was also determined to serve as a control. Correlations between resistance and mutation frequency were analyzed using Graphpad Prism 5.
Results
Resistance to deltamethrin and cyhalothrin
Levels of deltamethrin and cyhalothrin resistance measured in Cx. p. quinquefasciatus
Population | Insecticide | LC50(ppm) (95% CL)1 | Regression Equation | χ2 | P- value | RR2 |
---|---|---|---|---|---|---|
LA | deltamethrin | 0.001 (0.001, 0.001) | Y = 7.412 + 2.371x | 29.78 | 0.019 | 1 |
cyhalothrin | 0.001 (0.001, 0.001) | Y = 6.819 + 2.356x | 16.76 | 0.606 | 1 | |
CL | deltamethrin | 0.009 (0.006, 0.011) | Y = 3.028 + 1.475x | 13.34 | 0.648 | 9 |
cyhalothrin | 0.014 (0.010, 0.017) | Y = 2.898 + 1.551x | 10.63 | 0.832 | 14 | |
PX | deltamethrin | 0.428 (0.385, 0.476) | Y = 0.842 + 2.284x | 31.44 | 0.175 | 428 |
cyhalothrin | 0.396 (0.332, 0.468) | Y = 0.610 + 1.517x | 24.84 | 0.305 | 396 | |
BA | deltamethrin | 0.186 (0.151, 0.231) | Y = 1.314 + 1.799x | 23.34 | 0.105 | 186 |
cyhalothrin | 0.215 (0.172, 0.264) | Y = 0.761 + 1.139x | 23.28 | 0.386 | 215 | |
FH | deltamethrin | 1.019 (0.811, 1.268) | Y = -0.012 + 1.439x | 32.20 | 0.075 | 1019 |
cyhalothrin | 1.291 (1.051, 1.560) | Y = -0.165 + 1.484x | 16.83 | 0.396 | 1291 | |
ZJ | deltamethrin | 0.036 (0.031, 0.041) | Y = 3.073 + 2.127x | 18.05 | 0.703 | 36 |
cyhalothrin | 0.042 (0.037, 0.048) | Y = 3.048 + 2.215x | 26.82 | 0.218 | 42 | |
LS | deltamethrin | 0.312 (0.234, 0.413) | Y = 0.630 + 0.541x | 40.04 | 0.011 | 312 |
cyhalothrin | 0.641 (0.520, 0.800) | Y = 0.221 + 0.497x | 25.05 | 0.295 | 641 |
Sodium channel gene mutations
Alternative splicing in the sodium channel gene of Cx. p. quinquefasciatus. CX1 was the sequence of Cx. p. quinquefasciatus (GenBank Accession No.: AB453977.1). CX2 was the sequence of Cx. p. quinquefasciatus in China. The dots indicated the alternative splicings. In the 517–570, there were three kinds of alternative splicings (517–550, 542–550, and 542–570); In the 1106–1139, there were also three kinds of alternative splicings (1106–1118, 1106–1128, and 1106–1139).
Genetic and genotypic frequencies
Gene and genotype frequencies of seven sodium channel gene mutations calculated in six populations of Cx. p. quinquefasciatus
Mutation | Population | n | Genotype frequency and gene frequency (%) | |||
---|---|---|---|---|---|---|
SS1 | RS2 | RR3 | R4 | |||
V250M | FH | 49 | 61.2 | 34.7 | 4.10 | 21.4 |
PX | 31 | 41.9 | 48.4 | 9.70 | 33.9 | |
BA | 29 | 55.2 | 37.9 | 6.90 | 25.9 | |
ZJ | 31 | 48.4 | 51.6 | 0.00 | 25.8 | |
CL | 32 | 65.6 | 34.4 | 0.00 | 17.2 | |
LS | 36 | 61.1 | 27.8 | 11.1 | 25.0 | |
R436K | FH | 27 | 7.40 | 92.6 | 0.00 | 46.3 |
PX | 12 | 0.00 | 100 | 0.00 | 50.0 | |
BA | 10 | 0.00 | 100 | 0.00 | 50.0 | |
ZJ | 20 | 0.00 | 100 | 0.00 | 50.0 | |
CL | 13 | 0.00 | 100 | 0.00 | 50.0 | |
LS | 15 | 6.70 | 93.3 | 0.00 | 46.7 | |
M943V | FH | 32 | 34.4 | 65.6 | 0.00 | 32.8 |
PX | 38 | 44.7 | 55.3 | 0.00 | 27.6 | |
BA | 31 | 32.3 | 67.7 | 0.00 | 33.9 | |
ZJ | 33 | 48.5 | 51.5 | 0.00 | 25.8 | |
CL | 32 | 28.1 | 71.9 | 0.00 | 35.9 | |
LS | 31 | 16.1 | 83.9 | 0.00 | 41.9 | |
I973T | FH | 32 | 46.9 | 53.1 | 0.00 | 26.7 |
PX | 38 | 39.5 | 60.5 | 0.00 | 30.3 | |
BA | 31 | 29.0 | 71.0 | 0.00 | 35.5 | |
ZJ | 33 | 51.5 | 48.5 | 0.00 | 24.2 | |
CL | 32 | 37.5 | 62.5 | 0.00 | 31.3 | |
LS | 31 | 32.3 | 67.7 | 0.00 | 33.9 | |
L1035F | FH | 35 | 0.00 | 11.4 | 68.6 | 74.3 |
PX | 38 | 5.26 | 18.4 | 44.7 | 54.0 | |
BA | 31 | 16.1 | 45.2 | 29.0 | 51.6 | |
ZJ | 33 | 9.09 | 45.5 | 6.06 | 28.8 | |
CL | 32 | 3.13 | 68.8 | 21.9 | 56.3 | |
LS | 31 | 0.00 | 12.9 | 58.1 | 64.5 | |
L1035S | FH | 35 | 0.00 | 20.0 | 0.00 | 10.0 |
PX | 38 | 5.26 | 31.6 | 0.00 | 15.8 | |
BA | 31 | 16.1 | 9.68 | 0.00 | 4.84 | |
ZJ | 33 | 9.09 | 36.4 | 3.03 | 21.2 | |
CL | 32 | 3.13 | 6.25 | 0.00 | 3.13 | |
LS | 31 | 0.00 | 25.8 | 3.23 | 16.1 | |
E1901D | FH | 32 | 34.4 | 50.0 | 15.6 | 40.6 |
PX | 31 | 38.7 | 58.1 | 3.22 | 32.3 | |
BA | 34 | 55.9 | 44.1 | 0.00 | 22.1 | |
ZJ | 30 | 83.3 | 16.7 | 0.00 | 8.33 | |
CL | 22 | 40.9 | 59.1 | 0.00 | 29.6 | |
LS | 38 | 34.2 | 41.1 | 23.7 | 44.7 |
Analysis of genetic linkage between mutations
P-value of HWE test for heterozygote deficiency and excess confirmed at six loci in six Cx. p. quinquefasciatus populations
Mutations | FH | PX | BA | ZJ | CL | LS | All populations | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Def. | Exc. | Def. | Exc. | Def. | Exc. | Def. | Exc. | Def. | Exc. | Def. | Exc. | P-value | |
V250M | 0.6638 | 0.8045 | 0.8784 | 0.3797 | 0.5647 | 0.8103 | 1.0000 | 0.0729 | 1.0000 | 0.7097 | 0.0144 | 0.9992 | 0.3499 |
R436K | 1.0000 | 0.0018 | 1.0000 | 0.0018 | 1.0000 | 0.0115 | 1.0000 | 0.0000 | 1.0000 | 0.0008 | 1.0000 | 0.0017 | <0.01 |
M943V | 1.0000 | 0.0060 | 1.0000 | 0.0218 | 1.0000 | 0.0047 | 1.0000 | 0.0611 | 1.0000 | 0.0020 | 1.0000 | 0.0001 | <0.01 |
I973T | 1.0000 | 0.0523 | 1.0000 | 0.0218 | 1.0000 | 0.0026 | 1.0000 | 0.0904 | 1.0000 | 0.0175 | 1.0000 | 0.0050 | <0.01 |
L1035F/S | 0.4900 | 0.5000 | 0.4186 | 0.5748 | 0.5859 | 0.4458 | 0.9620 | 0.0349 | 0.9990 | 0.0012 | 0.2784 | 0.7220 | <0.01 |
E1901D | 1.0000 | 0.0553 | 0.9902 | 0.0881 | 1.0000 | 0.3579 | 1.0000 | 0.8282 | 1.0000 | 0.2919 | 0.4961 | 0.7498 | 0.3615 |
Chi-squared test results showed linkage between pairs of loci across six populations of Cx. p. quinquefasciatus (Fisher’s method)
Locus pair | χ2 | df | P- value |
---|---|---|---|
V250M & R436K | 0.0000 | 2 | 1.0000 |
V250M & M943V | 10.307 | 12 | 0.5890 |
R436K & M943V | 0.0000 | 2 | 1.0000 |
V250M & I973T | 13.680 | 12 | 0.3216 |
R436K & I973T | 0.0000 | 2 | 1.0000 |
M943V & I973T | Infinity | 12 | <0.01 |
V250M & L1035F/S | 13.758 | 12 | 0.3164 |
R436K & L1035F/S | 1.1216 | 2 | 0.5707 |
M943V & L1035F/S | 20.486 | 12 | 0.0584 |
I973T & L1035F/S | 20.864 | 12 | 0.0524 |
V250M & E1901D | 12.551 | 12 | 0.4025 |
R436K & E1901D | 0.0000 | 2 | 1.0000 |
M943V & E1901D | 8.3050 | 12 | 0.7609 |
I973T & E1901D | 6.0710 | 12 | 6.0710 |
L1035F/S & E1901D | 16.813 | 12 | 0.1568 |
Correlation between resistance and mutation frequencies
Correlations calculated between frequencies of sodium channel gene mutations in Cx. p. quinquefasciatus and resistance to deltamethrin and cyhalothrin
Mutations | Insecticide | R (95% CL) | R2 | P- value (α = 0.05) |
---|---|---|---|---|
V250M | deltamethrin | 0.054(-0.793,0.829) | 0.003 | 0.460 |
cyhalothrin | -0.046(-0.827,0.795) | 0.002 | 0.465 | |
M973V | deltamethrin | 0.022(-0.804,0.819) | 0.001 | 0.483 |
cyhalothrin | 0.235(-0.713,0.879) | 0.055 | 0.327 | |
I973T | deltamethrin | -0.240(-0.880,0.710) | 0.058 | 0.323 |
cyhalothrin | -0.158(-0.859,0.750) | 0.025 | 0.383 | |
L1035F | deltamethrin | 0.732(-0.197,0.968) | 0.536 | 0.049 |
cyhalothrin | 0.791(-0.057,0.976) | 0.626 | 0.030 | |
L1035S | deltamethrin | 0.007( -0.809,0.814) | 0.000 | 0.495 |
cyhalothrin | 0.040( -0.797,0.825) | 0.002 | 0.470 | |
L1035F + L1035S | deltamethrin | 0.813( 0.005,0.979) | 0.661 | 0.025 |
cyhalothrin | 0.896( 0.309,0.989) | 0.803 | 0.008 | |
E1901D | deltamethrin | 0.609(-0.401,0.951) | 0.371 | 0.100 |
cyhalothrin | 0.710(-0.240,0.965) | 0.504 | 0.057 |
Linear regression of the relationship between the frequency of the L1035F mutation and deltamethrin resistance.
Linear regression of the relationship between the frequency of the L1035F mutation and cyhalothrin resistance.
Linear regression of the relationship between the frequency of the L1035 F + S mutation and deltamethrin resistance.
Linear regression of the relationship between the frequency of the L1035 F + S mutation and cyhalothrin resistance.
Linear regression of the relationship between deltamethrin and cyhalothrin resistance (LC 50 ) in Cx. p. quinquefasciatus .
Discussion
Insecticides have been used to control mosquitoes for more than half a century. Their indiscriminate use has, however, resulted in high levels of insecticide resistance in many mosquito species [8–10]. We tested the resistance of six Chinese Cx. p. quinquefasciatus populations to deltamethrin and cyhalothrin. Our results show that, compared to a susceptible laboratory strain, these six populations displayed a 9- to 1019-fold resistance to deltamethrin, and a 14- to 1291-fold resistance to cyhalothrin. The high resistance of the FH population may be related to its breeding habitat. This population frequently breeds in pools of water in peasant courtyards that are often polluted by insecticides.
The frequent use of insecticides has created an intense selection pressure for traits that confer resistance to them, such as changes in behavior, epidermal structure, metabolic enzymes and target-site mutations. Resistance may be conferred by the development of one, or more, of these traits. Osta et al. found that the dramatic reduction in the frequency of the G119S mutation in Cx pipiens mosquitoes was probably due to the increased use of pyrethroids over organosphosphate insecticides [35]. Therefore, alternating between different kinds of insecticide is one way of reducing the development of resistance to any one type.
We identified seven point mutations at six loci and eleven alternative splices in the sodium channel gene of Chinese Cx. p. quinquefasciatus. The Hardy–Weinberg equilibrium (HWE) describes the theoretical frequency of two alleles at the same locus, in the absence of mutation and selection, in an indefinitely large population with discrete generations after one generation of random mating [36]. The results of HWE tests suggested that mutations at four of these six loci significantly deviated from the HWE (P < 0.05). Among these, the R436K mutation occurred at a frequency of nearly 50% in all six populations and there was an excess of heterozygotes with this mutation (P < 0.05). How this mutation developed and its role, if any, in pesticide resistance requires further investigation.
Mutations at three other loci (M943, I973 and L1035) also deviated from the HWE, and some populations had an excess of heterozygotes with these mutations. L1014 (L1035 according to our sequencing) is a classical mutation associated with the use of pyrethroid insecticides. One reason why the previous three mutations deviate from the HWE may be because a long period of selection has led to them becoming fixed. Mutations at two other loci (V250M and E1901D) did not deviate from the HWE.
We found evidence of significant linkage between the M943V and I973T mutations (P < 0.01) and P- values for a Chi-squared test of association between L1014F/S and M943V and I973T were also only slightly above 0.05. Our sequencing data support linkage between these mutations in some mosquitoes but this requires further confirmation.
The V250M mutation is the first to be discovered in the Cx. p. quinquefasciatus sodium channel gene’s IS4 domain, in which mutations rarely occur. The frequency of this mutation was not correlated with resistance to either deltamethrin or cyhalothrin so further research is required to determine its function, if any, in pesticide resistance.
Our results provide the first confirmation of the R436K mutation, located between the first and second homology domains of the sodium channel gene near the IS6 domain, in Cx. p. quinquefasciatus. The E434K mutation was first identified near the IS6 domain of the sodium channel gene in the German cockroach. This mutation is associated with two other mutations, C764R and L993F (L1014F), that are closely linked to resistance to the pyrethroid insecticide cypermethrin [37]. We did not find any correlation between the frequency of this mutation and pyrethroid resistance. However, almost all individuals with this mutation were heterozygotes and its frequency was almost 50% across all populations. The reasons for its prevalence require further investigation.
The M943V and I973T mutations are located at the junctions between IIS4 and IIS5, and between IIS5 and IIS6, in the sodium channel gene and were significantly linked (P < 0.01). The M943V mutation is only three amino acids from the M918T site (the amino acid number in the housefly sodium channel gene, GenBank Accession No.: X96668). The M918T mutation is usually associated with the L1014F mutation in which case it confers “super-kdr” resistance. However, some studies have reported super-kdr resistance in the absence of the L1014F mutation. For example, Benjamin et al. found that the M918T mutation greatly increased the resistance of Tetranychus evansi to pyrethroid insecticides in the absence of the L1014F mutation [38].
The I874M mutation (corresponding to the M918 position in the housefly) in mammals can result in a 100-fold desensitization of the sodium channel [39]. Another study identified a methionine to valine replacement at this position in the Bemisia tabaci para-sodium channel gene that was unrelated to resistance [40]. We also detected a methionine to valine replacement at the fourth amino acid after the M918 position in all six Cx. p. quinquefasciatus populations that was not correlated with deltamethrin or cyhalothrin resistance. How this mutation arose, its connection with the M918 point mutation, linkage with the I973T mutation and role, if any, in resistance, requires further investigation.
L1035 is the site of the classic knockdown resistance mutation L1014 (amino acid number in the housefly sodium channel gene, GenBank Accession No.: X96668). It is located in the IIS6 domain of sodium channel, and has been relatively well researched. Subsequent studies have identified mutations associated with knockdown resistance in a variety of insects, for example, Aphis gossypii[15], the German cockroach [16], Myzus persicae[17]Triatoma infestans[21], Anopheles gambiae, Anopheles stephensi and Anopheles arabiensis[22]. In addition, recent studies have that the L1014S mutation is associated with permethrin, cypermethrin, cyhalothrin and DDT resistance in Anopheles sinensis, An. vagus and An. peditaeniatus, [41]; with deltamethrin resistance in Cx p. pallens[42], and with permethrin and DDT resistance in Anopheles gambiae[13, 43].
Another study found a new mutation, V1010L, that is closely linked to the L1014S mutation in Anopheles culicifacies but did not mention if it was associated with resistance [25]. As previously mentioned, the co-occurrence of the L1014F and M918T mutations can lead to super-kdr resistance in many insects. For example, these two mutations are closely related to cyhalothrin and permethrin resistance in Haematobia irritans[29]; and resistance to a suite (permethrin, bifenthrin, tefluthrin, deltamethrin, cypermethrin, cyhalothrin and fluvalinate) of pyrethoid insecticides in Myzus persicae[30]. No one has so far, however, detected super-kdr resistance in a mosquito species.
In Drosophila melanogaster, the L1014F, M918T and T929I mutations affect the sodium channel currents in the presence of deltamethrin and permethrin, suggesting that these mutations confer resistance to those pesticides [44]. Other authors have found the above three mutations in the sodium channel gene of pyrethroid-resistant Thrips tabaci[45] and identified the L1014H, L1014C and L1014W mutations [26–28, 46, 47].
Studies have showed mutations in L1014 could lead to a reduction in susceptibility to a variety of pyrethroids and a decay of tail current. And then lead to develop resistance [48, 49]. We found that the L1035F and L1035S mutations were present in all six Cx. p. quinquefasciatus populations we sampled and that these mutations were significantly correlated with deltamethrin and cyhalothrin resistance. This may be related to the frequent use of these pesticides at our sampling sites. In addition, we found that the frequency of the leucine to serine replacement in all six populations was lower than that of the L1035F mutation. The combined frequency of the L1035F and S mutations was highly correlated with resistance, especially cyhalothrin resistance (R2 = 0.803, P < 0.01), which suggests that mosquitoes in the sampled populations have developed additional mutations except the L1035F mutation in response to strong selection pressure.
This study was the first to detect the E1901D mutation, located on the sodium channel C-terminal tail, in Cx. p. quinquefasciatus. There has, so far, been relatively little research on this fragment but it appears to be unrelated to deltamethrin and cyhalothrin resistance. Determining the function of such mutations will require further study.
We confirmed eleven alternative splices in the sodium channel gene of Cx. p. quinquefasciatus. These reflect dynamic change and higher level reassembly of genetic information that can greatly increase the richness of the coding sequence without changing genomic DNA [50]. Liu et al. (2012) found thirteen different sodium channel variants in Cx. p. quinquefasciatus and demonstrated that this alternative splicing was related to pyrethroid resistance [51]. The eleven alternative splices we found differed from those found by Liu et al. They may have some significance in the rich diversity of the sodium channel protein, but further research is required to determine their role, if any, in pyrethroid resistance.
Conclusion
In the study, seven amino acid alterations were found (V250M, R436K, M943V, I973T, L1035F, L1035S and E1901D) in the sodium channel gene of Cx. p. quinquefasciatus from six field populations in China. Among them, the L1035F and L1035S mutations’ frequencies were associated with resistance to deltamethrin and cyhalothrin. And the M943V and I973T mutations were significant linkage with each other in the sodium channel gene. Identifying these mutations may be of practical benefit to the development of pesticide resistance management programs.
Declarations
Acknowledgments
This work was funded by grants from the Infective Diseases Prevention and Cure Project of China (No.2008ZX10004 and No.2012ZX10004219).
Authors’ Affiliations
References
- WHO: Geographical Distribution of Arthropod-Borne Diseases and their Principal Vectors. 1989Google Scholar
- Kwan JL, Kluh S, Madon MB, Reisen WK: West Nile virus emergence and persistence in Los Angeles, California, 2003–2008. Am J Trop Med Hyg. 2010, 83 (2): 400-10.4269/ajtmh.2010.10-0076.PubMed CentralView ArticlePubMedGoogle Scholar
- Savage HM, Smith GC, Moore CG, Mitchell CJ, Townsend M, Marfin AA: Entomologic investigations of an epidemic of St. Louis encephalitis in Pine Bluff, Arkansas, 1991. Am J Trop Med Hyg. 1993, 49 (1): 38-45.PubMedGoogle Scholar
- Turell MJ, Linthicum KJ, Patrican LA, Davies FG, Kairo A, Bailey CL: Vector competence of selected African mosquito (Diptera: Culicidae) species for Rift Valley fever virus. J Med Entomol. 2008, 45 (1): 102-108. 10.1603/0022-2585(2008)45[102:VCOSAM]2.0.CO;2.View ArticlePubMedGoogle Scholar
- Sang R, Kioko E, Lutomiah J, Warigia M, Ochieng C, O’Guinn M, Lee JS, Koka H, Godsey M, Hoel D: Rift Valley fever virus epidemic in Kenya, 2006/2007: the entomologic investigations. Am J Trop Med Hyg. 2010, 83 (2): 28-PubMed CentralView ArticlePubMedGoogle Scholar
- Narahashi T: Molecular and cellular approaches to neurotoxicology: past, present and future. Neurotox. 1988, 88: 563-582.Google Scholar
- Kawada H, Dida GO, Ohashi K, Komagata O, Kasai S, Tomita T, Sonye G, Maekawa Y, Mwatele C, Njenga SM: Multimodal pyrethroid resistance in malaria vectors, Anopheles gambiae ss, Anopheles arabiensis, and Anopheles funestus ss in western Kenya. PLoS One. 2011, 6 (8): e22574-10.1371/journal.pone.0022574.PubMed CentralView ArticlePubMedGoogle Scholar
- Jones CM, Machin C, Mohammed K, Majambere S, Ali AS, Khatib BO, Mcha J, Ranson H, Kelly-Hope LA: Insecticide resistance in Culex quinquefasciatus from Zanzibar: implications for vector control programmes. Parasit Vectors. 2012, 5: 78-10.1186/1756-3305-5-78.PubMed CentralView ArticlePubMedGoogle Scholar
- Akiner M, Simsek F, Caglar S: Insecticide resistance of Culex pipiens (Diptera: Culicidae) in Turkey. J Pestic Sci. 2009, 34: 4View ArticleGoogle Scholar
- Balkew M, Ibrahim M, Koekemoer LL, Brooke BD, Engers H, Aseffa A, Gebre-Michael T, Elhassen I: Research Insecticide resistance in Anopheles arabiensis (Diptera: Culicidae) from villages in central, northern and south west Ethiopia and detection of kdr mutation. Parasit Vectors. 2010, 3: 40-10.1186/1756-3305-3-40.PubMed CentralView ArticlePubMedGoogle Scholar
- Sarkar M, Bhattacharyya IK, Borkotoki A, Baruah I, Srivastava RB: Development of physiological resistance and its stage specificity in Culex quinquefasciatus after selection with deltamethrin in Assam. India Memórias do Instituto Oswaldo Cruz. 2009, 104 (5): 673-677. 10.1590/S0074-02762009000500001.View ArticlePubMedGoogle Scholar
- Chandre F, Darrier F, Manga L, Akogbeto M, Faye O, Mouchet J, Guillet P: Status of pyrethroid resistance in Anopheles gambiae sensu lato. Bull World Health Organ. 1999, 77 (3): 230-234.PubMed CentralPubMedGoogle Scholar
- Ranson H, Jensen B, Vulule J, Wang X, Hemingway J, Collins F: Identification of a point mutation in the voltage-gated sodium channel gene of Kenyan Anopheles gambiae associated with resistance to DDT and pyrethroids. Insect Mol Biol. 2000, 9 (5): 491-497. 10.1046/j.1365-2583.2000.00209.x.View ArticlePubMedGoogle Scholar
- Dong K: Insect sodium channels and insecticide resistance. Invert Neurosci. 2007, 7 (1): 17-30. 10.1007/s10158-006-0036-9.PubMed CentralView ArticlePubMedGoogle Scholar
- Marshall KL, Moran C, Chen Y, Herron GA: Detection of kdr pyrethroid resistance in the cotton aphid, Aphis gossypii (Hemiptera: Aphididae), using a PCR-RFLP assay. J Pestic Sci. 2012, 37: 2-View ArticleGoogle Scholar
- Dong K: A single amino acid change in the para sodium channel protein is associated with knockdown-resistance (kdr) to pyrethroid insecticides in German cockroach. Insect Biochem Mol Biol. 1997, 27 (2): 93-100. 10.1016/S0965-1748(96)00082-3.View ArticlePubMedGoogle Scholar
- Martinez-Torres D, Foster S, Field L, Devonshire A, Williamson M: A sodium channel point mutation is associated with resistance to DDT and pyrethroid insecticides in the peach-potato aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae). Insect Mol Biol. 1999, 8 (3): 339-346. 10.1046/j.1365-2583.1999.83121.x.View ArticlePubMedGoogle Scholar
- Brun-Barale A, Bouvier JC, Pauron D, Bergé JB, Sauphanor B: Involvement of a sodium channel mutation in pyrethroid resistance in Cydia pomonella L, and development of a diagnostic test. Pest Manag Sci. 2005, 61 (6): 549-554. 10.1002/ps.1002.View ArticlePubMedGoogle Scholar
- Forcioli D, Frey B, Frey J: High nucleotide diversity in the para-like voltage-sensitive sodium channel gene sequence in the western flower thrips (Thysanoptera: Thripidae). J Econ Entomol. 2002, 95 (4): 838-848. 10.1603/0022-0493-95.4.838.View ArticlePubMedGoogle Scholar
- Nauen R, Zimmer CT, Andrews M, Slater R, Bass C, Ekbom B, Gustafsson G, Hansen LM, Kristensen M, Zebitz CP: Target-site resistance to pyrethroids in European populations of pollen beetle, Meligethes aeneus F. Pestic Biochem Phys. 2012, 103 (3): 173-180. 10.1016/j.pestbp.2012.04.012.View ArticleGoogle Scholar
- Fabro J, Sterkel M, Capriotti N, Mougabure-Cueto G, Germano M, Rivera-Pomar R, Ons S: Identification of a point mutation associated with pyrethroid resistance in the para-type sodium channel of Triatoma infestans, a vector of Chagas’ disease. Infect Genet Evol. 2012, 12 (2): 487-491. 10.1016/j.meegid.2011.12.006.View ArticlePubMedGoogle Scholar
- Yewhalaw D, Wassie F, Steurbaut W, Spanoghe P, Van Bortel W, Denis L, Tessema DA, Getachew Y, Coosemans M, Duchateau L: Multiple insecticide resistance: an impediment to insecticide-based malaria vector control program. PLoS One. 2011, 6 (1): e16066-10.1371/journal.pone.0016066.PubMed CentralView ArticlePubMedGoogle Scholar
- Busvine J: Mechanism of resistance to insecticide in houseflies. Nature. 1951, 168: 193-195. 10.1038/168193a0.View ArticlePubMedGoogle Scholar
- Milani R: Mendelian behavior of resistance to the knock-down action of DDT and correlation between knock-down and mortality in Musca domestica L. Rendiconti-Istituto Superiore di Sanita. 1955, 19 (11): 1107-1143.Google Scholar
- Singh OP, Dykes CL, Das MK, Pradhan S, Bhatt RM, Agrawal OP, Adak T: Research Presence of two alternative kdr-like mutations, L1014F and L1014S, and a novel mutation, V1010L, in the voltage gated Na + channel of Anopheles culicifacies from Orissa. India Malaria J. 2010, 9: 146-10.1186/1475-2875-9-146.View ArticleGoogle Scholar
- Liu N, Pridgeon JW: Metabolic detoxication and the kdr mutation in pyrethroid resistant house flies, Musca domestica (L.). Pestic Biochem Phys. 2002, 73 (3): 157-163. 10.1016/S0048-3575(02)00101-3.View ArticleGoogle Scholar
- Tan WL, Li CX, Wang ZM, Liu MD, Dong YD, Feng XY, Wu ZM, Guo XX, Xing D, Zhang YM: First Detection of Multiple Knockdown Resistance (kdr)-Like Mutations in Voltage-Gated Sodium Channel Using Three New Genotyping Methods in Anopheles sinensis From Guangxi Province, China. J Med Entomol. 2012, 49 (5): 1012-1020. 10.1603/ME11266.View ArticlePubMedGoogle Scholar
- WANG ZM LICX, Xing D, YU YH, Liu N, XUE RD DONGYD, ZHAO TY: Detection and widespread distribution of sodium channel alleles characteristic of insecticide resistance in Culex pipiens complex mosquitoes in China. Med Vet Entomol. 2012, 26 (2): 228-232. 10.1111/j.1365-2915.2011.00985.x.View ArticlePubMedGoogle Scholar
- Guerrero FD, Jamroz RC, Kammlah D, Kunz SE: Toxicological and molecular characterization of pyrethroid-resistant horn flies, Haematobia irritans: identification of kdr and super-kdr point mutations. Insect Biochem Molec. 1997, 27 (8): 745-755.View ArticleGoogle Scholar
- Eleftherianos I, Foster S, Williamson M, Denholm I: Characterization of the M918T sodium channel gene mutation associated with strong resistance to pyrethroid insecticides in the peach-potato aphid, Myzus persicae (Sulzer). Bull Entomol Res. 2008, 98 (02): 183-191.View ArticlePubMedGoogle Scholar
- Williamson MS, Martinez-Torres D, Hick CA, Devonshire AL: Identification of mutations in the houseflypara-type sodium channel gene associated with knockdown resistance (kdr) to pyrethroid insecticides. Mol Gen Genet. 1996, 252 (1–2): 51-60.View ArticlePubMedGoogle Scholar
- Cetin H, Yanikoglu A, Cilek JE: Evaluation of the naturally-derived insecticide spinosad against Culex pipiens L.(Diptera: Culicidae) larvae in septic tank water in Antalya, Turkey. J Vector Ecol. 2005, 30 (1): 151-154.PubMedGoogle Scholar
- Zhao MH, Ran X, Dong YD, Guo XX, Zhang YM, Xing D, Wu ZM, Li CX, Zhao TY: Clone and Sequencing of Sodium Channel Gene from Field Culex Pipiens Pallens. Acta Parasitologica Et Medica Entomologica Sinica. 2014, 21 (1): 17-22.Google Scholar
- Li CX, Dong YD, Song FL, Zhang XL, Zhao TY: An amino acid substitution on the acetylcholinesterase in the field strains of house mosquito, Culex pipiens pallens (Diptera: Culicidae) in China. Entomol News. 2009, 120 (5): 464-475. 10.3157/021.120.0502.View ArticleGoogle Scholar
- Osta MA, Rizk ZJ, Labbé P, Weill M, Knio K: Insecticide resistance to organophosphates in Culex pipiens complex from Lebanon. Parasit Vectors. 2012, 5 (1): 1-6. 10.1186/1756-3305-5-1.View ArticleGoogle Scholar
- Mayo O: A century of Hardy–Weinberg equilibrium. Twin Res Hum Genet. 2008, 11 (03): 249-256. 10.1375/twin.11.3.249.View ArticlePubMedGoogle Scholar
- Liu Z, Valles SM, Dong K: Novel point mutations in the German cockroach para sodium channel gene are associated with knockdown resistance (kdr) to pyrethroid insecticides. Insect Biochem Molec. 2000, 30 (10): 991-997. 10.1016/S0965-1748(00)00074-6.View ArticleGoogle Scholar
- Nyoni BN, Gorman K, Mzilahowa T, Williamson MS, Navajas M, Field LM, Bass C: Pyrethroid resistance in the tomato red spider mite, Tetranychus evansi, is associated with mutation of the para-type sodium channel. Pest Manag Sci. 2011, 67 (8): 891-897. 10.1002/ps.2145.View ArticlePubMedGoogle Scholar
- Vais H, Atkinson S, Eldursi N, Devonshire A, Williamson M, Usherwood P: A single amino acid change makes a rat neuronal sodium channel highly sensitive to pyrethroid insecticides. FEBS Lett. 2000, 470 (2): 135-138. 10.1016/S0014-5793(00)01305-3.View ArticlePubMedGoogle Scholar
- Morin S, Williamson M, Goodson S, Brown J, Tabashnik B, Dennehy T: Mutations in the Bemisia tabaci para sodium channel gene associated with resistance to a pyrethroid plus organophosphate mixture. Insect Biochem Molec. 2002, 32 (12): 1781-1791. 10.1016/S0965-1748(02)00137-6.View ArticleGoogle Scholar
- Verhaeghen K, Van Bortel W, Trung HD, Sochantha T, Keokenchanh K, Coosemans M: Knockdown resistance in Anopheles vagus, An. sinensis, An. paraliae and An. peditaeniatus populations of the Mekong region. Parasit Vectors. 2010, 3 (1): 59-10.1186/1756-3305-3-59.PubMed CentralView ArticlePubMedGoogle Scholar
- Chen L, Zhong D, Zhang D, Shi L, Zhou G, Gong M, Zhou H, Sun Y, Ma L, He J: Molecular ecology of pyrethroid knockdown resistance in Culex pipiens pallens mosquitoes. PLoS One. 2010, 5 (7): e11681-10.1371/journal.pone.0011681.PubMed CentralView ArticlePubMedGoogle Scholar
- Stump AD, Atieli FK, Vulule JM, Besansky NJ: Dynamics of the pyrethroid knockdown resistance allele in western Kenyan populations of Anopheles gambiae in response to insecticide-treated bed net trials. Am J Trop Med Hyg. 2004, 70 (6): 591-596.PubMedGoogle Scholar
- Vais H, Atkinson S, Pluteanu F, Goodson S, Devonshire A, Williamson M, Usherwood P: Mutations of the para sodium channel of Drosophila melanogaster identify putative binding sites for pyrethroids. Mol Pharmacol. 2003, 64 (4): 914-922. 10.1124/mol.64.4.914.View ArticlePubMedGoogle Scholar
- Toda S, Morishita M: Identification of three point mutations on the sodium channel gene in pyrethroid-resistant Thrips tabaci (Thysanoptera: Thripidae). J Econ Entomol. 2009, 102 (6): 2296-2300. 10.1603/029.102.0635.View ArticlePubMedGoogle Scholar
- Park Y, Taylor MF: A novel mutation L1029H in sodium channel gene hscp associated with pyrethroid resistance for Heliothis virescens (Lepidoptera: Noctuidae). Insect Biochem Molec. 1997, 27 (1): 9-13. 10.1016/S0965-1748(96)00077-X.View ArticleGoogle Scholar
- Kim H, Baek JH, Lee W-J, Lee SH: Frequency detection of pyrethroid resistance allele inAnopheles sinensis populations by real-time PCR amplification of specific allele (rtPASA). Pestic Biochem Phys. 2007, 87 (1): 54-61. 10.1016/j.pestbp.2006.06.009.View ArticleGoogle Scholar
- Smith TJ, Lee SH, Ingles PJ, Knipple DC, Soderlund DM: The L1014F point mutation in the house fly Vssc1 sodium channel confers knockdown resistance to pyrethroids. Insect Biochem Mol Biol. 1997, 27 (10): 807-812. 10.1016/S0965-1748(97)00065-9.View ArticlePubMedGoogle Scholar
- Vais H, Williamson MS, Goodson SJ, Devonshire AL, Warmke JW, Usherwood PN, Cohen CJ: Activation of Drosophila sodium channels promotes modification by deltamethrin. Reductions in affinity caused by knock-down resistance mutations. J Gen Physiol. 2000, 115 (3): 305-318. 10.1085/jgp.115.3.305.PubMed CentralView ArticlePubMedGoogle Scholar
- Blencowe BJ: Alternative splicing: new insights from global analyses. Cell. 2006, 126 (1): 37-47. 10.1016/j.cell.2006.06.023.View ArticlePubMedGoogle Scholar
- He L, Li T, Zhang L, Liu N: Multiple sodium channel variants in the mosquito Culex quinquefasciatus. Int J Biol Sci. 2012, 8 (10): 1291-10.7150/ijbs.4966.PubMed CentralView ArticlePubMedGoogle Scholar
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.