Skip to main content

Advertisement

Table 1 PCR primer pairs used in this study

From: Detection of tick-borne ‘Candidatus Neoehrlichia mikurensis’ and Anaplasma phagocytophilum in Spain in 2013

Gene target Primer name Primer sequence 5’→ 3’ Amplified fragment (bp) Annealing temperature (ºC) Reference
groESL heat shock operon of Anaplasma spp. (nested) HS1a AITGGGCTGGTAITGAAAT 1350 48 [9]
HS6a CCICCIGGIACIAIACCTTC
HS43 AT(A/T)GC(A/T)AA(G/A)GAAGCATAGTC 1297 55
HSVR CTCAACAGCAGCTCTAGTAGC
16S rRNA (nested) ge3a CACATGCAAGTCGAACGGATTATTC 932 55 [10]
ge10r TTCCGTTAAGAAGGAT CTAATCTCC
ge9f AACGGATTATTCTTTATAGCTTGCT 546 55
ge2 GGCAGTATTAAAAGCAGCTCCAGG
16S rRNA EHR EHR 16SD GGTACCYACAGAAGAAGTCC 345 55 [11]
EHR 16SR TAGCACTCATCGTTTACAGC