Open Access

Detection of tick-borne ‘Candidatus Neoehrlichia mikurensis’ and Anaplasma phagocytophilum in Spain in 2013

  • Ana M Palomar1,
  • Lara García-Álvarez1,
  • Sonia Santibáñez1,
  • Aránzazu Portillo1 and
  • José A Oteo1Email author
Parasites & Vectors20147:57

https://doi.org/10.1186/1756-3305-7-57

Received: 11 December 2013

Accepted: 29 January 2014

Published: 31 January 2014

Abstract

Background

Candidatus Neoehrlichia mikurensis’ is a tick-borne bacteria implicated in human health. To date, ‘Ca. Neoehrlichia mikurensis’ has been described in different countries from Africa, Asia and Europe, but never in Spain. However, according to the epidemiological features of the main vector in Europe, Ixodes ricinus, its circulation in our country was suspected.

Methods

A total of 200 I. ricinus ticks collected in the North of Spain were analyzed. DNAs were extracted and used as templates for PCRs targeting fragment genes for Anaplasma/Ehrlichia detection. The amplified products were sequenced and analyzed.

Results

Ca. Neoehrlichia mikurensis’ was amplified in two specimens. Furthermore, Anaplasma phagocytophilum was detected in 61 samples analyzed.

Conclusions

The detection of ‘Ca. Neoehrlichia mikurensis’ in I. ricinus ticks from Spain indicates its circulation and the potential risk of contracting a human infection in this country.

Keywords

Candidatus Neoehrlichia mikurensis’ Anaplasma phagocytophilum Ixodes ricinus Spain

Background

‘Candidatus Neoehrlichia mikurensis’ is an obligate intracellular bacterium member of the Anaplasmataceae family. It was first isolated from wild rats (Rattus norvegicus) and Ixodes ovatus ticks in the Mikura Island, Japan [1]. It was classified as a new genus (Neoehrlichia) added to those already known of the Anaplasmataceae family: Ehrlichia, Anaplasma, Neorickettsia, Aegyptianella and Wolbachia[1].

The presence of ‘Ca. Neoehrlichia mikurensis’ in rodents and ticks has been notified from different countries of Europe, Asia and Africa in the last decade [2, 3]. In Europe, it has been mostly detected in Ixodes ricinus, although it has been associated to other tick species in other continents. I. ricinus, endemic in the North of Spain, is responsible for most human tick bites. It acts as vector of different human pathogens, such as Borrelia burgdorferi sensu lato (s.l.), Anaplasma phagocytophilum -formerly Ehrlichia phagocytophila- or different Rickettsia spp., protozoa and arboviruses. However, the risk of infections with ‘Ca. Neoehrlichia mikurensis’ to human health remains unclear in southern Europe.

The first implication of the bacterium in human pathology was reported in Sweden in 2010 [4]. Subsequently, seven new human cases severely affected by ‘Ca. Neoehrlichia mikurensis’ infections have been notified from Europe [58]. Several human cases have also been described in China [2].

‘Ca. Neoehrlichia mikurensis’ has not been previously described in Spain. However, according to the epidemiological features of the main vector, I. ricinus, in which the bacterium has been mostly detected in Europe, its circulation in our country was suspected.

Methods

In the routine analysis of tick-borne pathogens performed in the Center of Rickettsioses and Arthropod-borne Diseases (Logroño, Spain), 200 I. ricinus ticks collected from cows were tested. Samples were obtained in two different locations of La Rioja (Spain): Tobía (42°18’N; 2°48’W) and Jubera (42°18’N; 2°17’W) in April 2013. A total of 50 males and 50 engorged females from each location were processed. Ticks were kept at -80°C until DNA extraction with Qiagen DNeasy Blood & Tissue Kit, according to the manufacturer’s instructions (Qiagen, Hilden, Germany).

All DNA extracts were used as templates for two nested PCRs targeting fragment genes for Anaplasma/Ehrlichia detection. Furthermore, a simple PCR was performed to confirm the amplification of species never detected in the area (Table 1) [911]. Two negative controls, one of them containing water instead of template DNA and the other with template DNA but without primers, as well as a positive control of A. phagocytophilum were included in all PCR assays. Amplification products were sequenced, and nucleotide sequences were compared with those available in GenBank by using a Basic Local Alignment Search Tool (BLAST) search (http://www.ncbi.nlm.nih.gov/blast).
Table 1

PCR primer pairs used in this study

Gene target

Primer name

Primer sequence 5’→ 3’

Amplified fragment (bp)

Annealing temperature (ºC)

Reference

groESL heat shock operon of Anaplasma spp. (nested)

HS1a

AITGGGCTGGTAITGAAAT

1350

48

[9]

HS6a

CCICCIGGIACIAIACCTTC

HS43

AT(A/T)GC(A/T)AA(G/A)GAAGCATAGTC

1297

55

HSVR

CTCAACAGCAGCTCTAGTAGC

16S rRNA (nested)

ge3a

CACATGCAAGTCGAACGGATTATTC

932

55

[10]

ge10r

TTCCGTTAAGAAGGAT CTAATCTCC

ge9f

AACGGATTATTCTTTATAGCTTGCT

546

55

ge2

GGCAGTATTAAAAGCAGCTCCAGG

16S rRNA EHR

EHR 16SD

GGTACCYACAGAAGAAGTCC

345

55

[11]

EHR 16SR

TAGCACTCATCGTTTACAGC

Results and discussion

Two nucleotide sequences of groESL fragment gene (1%) corresponding to 2 male tick specimens collected in Tobía showed 100% identity with ‘Ca. Neoehrlichia mikurensis’. They were identical to the one detected in two patients in Germany [5]. None of them yielded positive results when PCR tests for 16S rRNA were performed. For this reason, a different fragment of the 16S rRNA gene (EHR) was investigated to confirm our previous results. Nucleotide sequences of both samples were identical to each other and showed 100% identity with more than one sequence of ‘Ca. Neoehrlichia mikurensis’ (Table 2). In our laboratory we had never worked with ‘Ca. Neoehrlichia mikurensis’ before, so no contamination with this bacterium was possible.
Table 2

Anaplasmataceae species detected in Ixodes ricinus removed from cows (N = 200) in La Rioja (North of Spain)

Bacterium (no.)

groESL

16S rRNA

16S rRNA-EHR

Ticks, number and stage

Genbank accession no.

Identity (%)

Ticks, number and stage

Genbank accession no.

Identity (%)

Ticks, number and stage

Genbank accession no.

Identity (%)

Tobía

Jubera

Tobía

Jubera

Tobía

Jubera

‘Ca. N. mikurensis’ (2)

2 M

 

EU810407

100

    

2 M

 

JQ675350

100

A. phagocytophilum (61)

            

Human pathogenic variant (8)

1 M, 2 F

2 M, 2 F

U72628

99.9-100

1 F*

2 F

U02521

100

    

Non-pathogenic variants (53)

1 M

 

AF478558

100

1 M

 

JN181071

100

    
 

1 M

 

AF478563

100

        
 

1 F

 

AY281831

100

 

1 F

EU839849

100

    
 

2 F

2 M, 7 F

EU246959

99.8-100

1 F

1 M, 4 F

JN181071

100

    
 

5 F

2 M, 29 F

AF548385

99.8-100

2 F

1 M, 11 F

JN181071

99.9-100

    
  

1 M

AY281830

100

 

1 M

JN181071

100

    

No.: number; ‘Ca. N. mikurensis’: ‘Candidatus Neoehrlichia mikurensis’; A. phagocytophilum: Anaplasma phagocytophilum; M: Male; F: Female; *: only amplified with 16S rRNA fragment gene; : Two of them only amplified with 16S rRNA fragment gene.

On the other hand, A. phagocytophilum was detected in 61 samples (30.5%) of this study. Specifically, 8 specimens (4%) showed maximum identity with the human pathogenic variant, and 53 (26.5%) with non-pathogenic variants (Table 2).

In this study, ‘Ca. Neoehrlichia mikurensis’ DNA was detected in two ticks from La Rioja (Spain) during 2013 but we do not know if this bacterium has been previously circulating in our area. Anyway, this infection may be underdiagnosed in our media. In addition, according to the recent finding of several human cases due to this bacterium, mainly in immunocompromised patients, physicians should be aware of the risk for those patients in the affected area. Moreover, infections and fever of unknown origin are common in immunocompromised patients and the responsible pathogen is not isolated in most cases [7]. The detection of ‘Ca. Neoehrlichia mikurensis’ and the features of the European human cases suggest that this microorganism is likely causing disease in our country too.

The prevalence of A. phagocytophilum in the studied area has been previously reported [12]. According to our results, the high prevalence of the bacterium in the engorged females collected in Jubera should be noted (40 out of 50 specimens, 80%). This could be due to the fact that all the female specimens processed were engorged on cows, hosts that are potential amplifiers of the bacterium [13].

Conclusions

‘Ca. Neoehrlichia mikurensis’ has been detected in I. ricinus ticks removed from cows in Spain. A. phagocytophilum was amplified in 61 out of 200 samples (8 of them corresponding to the human pathogenic variant). Our results suggest that human infections by ‘Ca. Neoehrlichia mikurensis’ might be undiagnosed in this country. Further research should be carried out to study the epidemiology of the bacterium as well as to be aware of possible human cases.

Declarations

Acknowledgments

Fundación Rioja Salud awarded a grant to the first author (FRS/PIF-01/10). We thank Luis Vergarechea for providing tick samples and Eduardo Cuesta for the support with the processing of samples.

Authors’ Affiliations

(1)
Departamento de Enfermedades Infecciosas, Hospital San Pedro-CIBIR, Center of Rickettsioses and Arthropod-Borne Diseases, C/ Piqueras, N° 98

References

  1. Kawahara M, Rikihisa Y, Isogai E, Takahashi M, Misumi H, Suto C, Shibata S, Zhang C, Tsuji M: Ultrastructure and phylogenetic analysis of ‘Candidatus Neoehrlichia mikurensis’ in the family Anaplasmataceae, isolated from wild rats and found in Ixodes ovatus ticks. Int J Syst Evol Microbiol. 2004, 54: 1837-1843. 10.1099/ijs.0.63260-0.View ArticlePubMedGoogle Scholar
  2. Li H, Jiang JF, Liu W, Zheng YC, Huo QB, Tang K, Zuo SY, Liu K, Jiang BG, Yang H, Cao WC: Human infection with ‘Candidatus neoehrlichia mikurensis’, China. Emerg Infect Dis. 2012, 18: 1636-1639. 10.3201/eid1810.120594.PubMed CentralView ArticlePubMedGoogle Scholar
  3. Kamani J, Baneth G, Mumcuoglu KY, Waziri NE, Eyal O, Guthmann Y, Harrus S: Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria. PLoS Negl Trop Dis. 2013, 7: e2108-10.1371/journal.pntd.0002108.PubMed CentralView ArticlePubMedGoogle Scholar
  4. Welinder-Olsson C, Kjellin E, Vaht K, Jacobsson S, Wenneras C: First case of human ‘Candidatus Neoehrlichia mikurensis’ infection in a febrile patient with chronic lymphocytic leukemia. J Clin Microbiol. 2010, 48: 1956-1959. 10.1128/JCM.02423-09.PubMed CentralView ArticlePubMedGoogle Scholar
  5. von Loewenich FD, Geissdörfer W, Disqué C, Matten J, Schett G, Sakka SG, Bogdan C: Detection of ‘Candidatus Neoehrlichia mikurensis’ in two patients with severe febrile illnesses: evidence for a European sequence variant. J Clin Microbiol. 2010, 48: 2630-2635. 10.1128/JCM.00588-10.PubMed CentralView ArticlePubMedGoogle Scholar
  6. Fehr JS, Bloemberg GV, Ritter C, Hombach M, Lüscher TF, Weber R, Keller PM: Septicemia caused by tick-borne bacterial pathogen ‘Candidatus Neoehrlichia mikurensis’. Emerg Infect Dis. 2010, 16: 1127-1129. 10.3201/eid1607.091907.PubMed CentralView ArticlePubMedGoogle Scholar
  7. Pekova S, Vydra J, Kabickova H, Frankova S, Haugvicova R, Mazal O, Cmejla R, Hardekopf DW, Jancuskova T, Kozak T: ‘Candidatus Neoehrlichia mikurensis’ infection identified in 2 hematooncologic patients: benefit of molecular techniques for rare pathogen detection. Diagn Microbiol Infect Dis. 2011, 69: 266-270. 10.1016/j.diagmicrobio.2010.10.004.View ArticlePubMedGoogle Scholar
  8. Maurer FP, Keller PM, Beuret C, Joha C, Achermann Y, Gubler J, Bircher D, Karrer U, Fehr J, Zimmerli L, Bloemberg GV: Close geographic association of human neoehrlichiosis and tick populations carrying ‘Candidatus Neoehrlichia mikurensis’ in eastern Switzerland. J Clin Microbiol. 2013, 51: 169-176. 10.1128/JCM.01955-12.PubMed CentralView ArticlePubMedGoogle Scholar
  9. Liz JS, Sumner JW, Pfister K, Brossard M: PCR detection and serological evidence of granulocytic ehrlichial infection in roe deer (Capreolus capreolus) and chamois (Rupicapra rupicapra). J Clin Microbiol. 2002, 40: 892-897. 10.1128/JCM.40.3.892-897.2002.PubMed CentralView ArticlePubMedGoogle Scholar
  10. Massung RF, Slater K, Owens JH, Nicholson WL, Mather TN, Solberg VB, Olson JG: Nested PCR assay for detection of granulocytic ehrlichiae. J Clin Microbiol. 1998, 36: 1090-1095.PubMed CentralPubMedGoogle Scholar
  11. Inokuma H, Raoult D, Brouqui P: Detection of Ehrlichia platys DNA in brown dog ticks (Rhipicephalus sanguineus) in Okinawa Island, Japan. J Clin Microbiol. 2000, 38: 4219-4221.PubMed CentralPubMedGoogle Scholar
  12. Portillo A, Pérez-Martínez L, Santibáñez S, Santibáñez P, Palomar AM, Oteo JA: Anaplasma spp. in wild mammals and Ixodes ricinus from the North of Spain. Vector Borne Zoonotic Dis. 2011, 11: 3-8. 10.1089/vbz.2009.0214.View ArticlePubMedGoogle Scholar
  13. Stuen S, Granquist EG, Silaghi C: Anaplasma phagocytophilum - a widespread multi-host pathogen with highly adaptive strategies. Front Cell Infect Microbiol. 2013, 3: 31-PubMed CentralView ArticlePubMedGoogle Scholar

Copyright

© Palomar et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.