Skip to main content

Table 1 Primers used for pathogen detection and tick genomic DNA amplificationa

From: Ticks and associated pathogens collected from cats in Sicily and Calabria (Italy)

Pathogen Region amplified Primer Forward (5’-3’) Primer Reverse (5’-3’) Final [primer] (μM) PCR Product (bp) Reference
Hepatozoon felis 18S rRNA CTTACCGTGGCAGTGACGGT TGTTATTTCTTGTCACTACCTCTCTTATGC 0.3 146 [11]
Ehrlichia/ Anaplasma spp. 16S rRNA GCAAGCYTAACACATGCAAGTCG CTACTAGGTAGATTCCTAYGCATTACTCACC 0.5 102b [11]
Piroplasmid 18S rRNA GACGATCAGATACCGTCGTAGTCC CAGAACCCAAAGACTTTGATTTCTCTC 0.3 114b VetGenomic In-house design
Rickettsia spp. ITS1 GCTCGATTGRTTTACTTTGCTGTGAG CATGCTATAACCACCAAGCTAGCAATAC 0.5/0.3 300b [11]
Bartonella spp. ITS1 AGATGATGATCCCAAGCCTTCTG CCTCCGACCTCACGCTTATCA 0.3 180b Modified from [12] and [13]
Hemotropic Mycoplasma spp. 16S GGAATCACTAGTAATCCYGTGTCAGCTATAT GGCGGTGTGTACAAGCCTGG 0.3 187b [14]
  1. aThe eukaryotic 18S RNA Pre-Developed TaqMan Assay Reagents (AB, Life technologies) was used as an internal reference for genomic DNA amplification to ensure the proper PCR amplification of each sample. bTargeted size could vary depending on the species