Open Access

Ticks and associated pathogens collected from cats in Sicily and Calabria (Italy)

  • Maria-Grazia Pennisi1,
  • Maria-Flaminia Persichetti2,
  • Lorena Serrano3,
  • Laura Altet3,
  • Stefano Reale4,
  • Laura Gulotta5 and
  • Laia Solano-Gallego6Email author
Contributed equally
Parasites & Vectors20158:512

https://doi.org/10.1186/s13071-015-1128-3

Received: 29 December 2014

Accepted: 1 October 2015

Published: 7 October 2015

Abstract

Background

Limited information is available about the species of ticks infesting the cat and the pathogens that they harbor. The aims of the present study were to identify the species of ticks removed from cats living in Sicily and Calabria (Italy) and to detect DNA of vector-borne pathogens in the same ticks.

Findings

Morphological identification of 132 adult ticks collected throughout the year from cats was carried out. Real-time PCRs for Hepatozoon felis, Piroplasmid, Ehrlichia/Anaplasma spp., Rickettsia spp., Bartonella spp., Mycoplasma spp. and Leishmania infantum were performed from each individual tick.

Ticks belonging to Rhipicephalus (R. sanguineus sensu lato, R. pusillus) and Ixodes (I. ricinus, I. ventalloi) genera were identified. Ixodes ventalloi was the most frequently found tick species (47 %).

The positivity rate to at least one pathogen was 14.4 % (19/132 ticks). Leishmania infantum, Rickettsia spp. (R. monacensis and R. helvetica), Bartonella spp. (B. clarridgeiae), Piroplasmid (Babesia vogeli), and Ehrlichia/Anaplasma spp. (E. canis) DNAs were amplified in 8.3, 5.3, 1.5, 0.75 and 0.75 % of ticks, respectively. Hepatozoon felis, Anaplasma spp. and hemotropic Mycoplasma spp. DNAs were not detected. Four (21.1 %) out of nineteen positive ticks were co-infected.

Conclusions

This study provides novel data about ticks infesting cats and the DNA of pathogens that they harbor. In Southern Italy, anti-tick prophylaxis should be implemented throughout the year in cats without neglecting winter time.

Keywords

Tick Cat PCR Ehrlichia Rickettsia Bartonella Leishmania and Babesia

Findings

Ticks (Acari: Ixodida) are vectors of many pathogens (VBPs) some of them considered emerging and worldwide spread [1]. Moreover, a zoonotic concern is associated with some agents such as Bartonella spp., Rickettsia spp., Ehrlichia spp., Babesia spp. and Anaplasma phagocytophilum [2]. In South Italy, the climate favors different tick species as previously described by some authors [3, 4]. However, limited information is available about the species of ticks infesting the cat and the pathogens that they harbor [1].

The aims of the present study were to identify the tick species removed from cats living in South Italy and to detect the DNA of some vector-borne pathogens in the same arthropods.

Methods

One hundred and thirty two ticks were collected between November 2011 and March 2013 throughout the year in three sites: Lipari (Eolian archipelago, Sicily, 38° 28’ 3’ N, 14° 57’ 14’ E), Reggio Calabria (Calabria, 38° 06’ N, 15° 39’ E) and Gioia Tauro (Calabria, (38°25’30’ N, 15° 53’ 51’ E). Ticks were removed by a veterinarian as a preventative measure from outdoor owned cats during consultation in Lipari (n = 60), in Reggio Calabria (n = 20) and in Gioia Tauro (2) and from stray cats included in trap-neuter-release programs in Lipari (n = 130), Reggio Calabria (n = 77) and Gioia Tauro (n = 19) during the physical examination. Therefore, ethical committee approval was not needed. Informed consent was obtained from all owners and from the legal representative of animal welfare groups in charge of the management of stray cats.

Collected ticks were stored up in alcohol 70°. Date of collection and place of residence of the cat were recorded. Tick species and instars were determined on the basis of morphometric characteristics following conventional keys and descriptions [57]. Tick gender and feeding status in adult ticks (engorged/not engorged) were also evaluated. DNA extraction was performed using High Pure PCR Template preparation kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions with some modifications [8]. Leishmania infantum real-time PCR test targeted the constant region in the minicircle kinetoplast DNA (NCBI accession number AF291093) [9]. A quantitative real-time PCR was performed as described [10]. Real-time PCR targeting Hepatozoon felis, hemotropic Mycoplasma spp., Ehrlichia/Anaplasma spp., Piroplasmid, Rickettsia spp. and Bartonella spp. was performed as described previously [1114]. The target amplified for each pathogen and the used primers as well as details regarding tick genomic DNA amplification are shown in Table 1. Each positive product of the real-time PCR was sequenced by the BigDye Terminator Cycle Sequencing Ready reaction Kit (AB, Life Technologies) using the same primers. Sequences obtained were compared with GenBank database (www.ncbi.nlm.nih.gov/BLAST). Statistical differences (P value <0.05) between positivity to at least one real-time PCR and tick genus, engorgement and gender were analysed by the chi-square or Fisher’s exact test using GraphPad Instat software. Associations were evaluated using Odds Ratio (OR).
Table 1

Primers used for pathogen detection and tick genomic DNA amplificationa

Pathogen

Region amplified

Primer Forward (5’-3’)

Primer Reverse (5’-3’)

Final [primer] (μM)

PCR Product (bp)

Reference

Hepatozoon felis

18S rRNA

CTTACCGTGGCAGTGACGGT

TGTTATTTCTTGTCACTACCTCTCTTATGC

0.3

146

[11]

Ehrlichia/ Anaplasma spp.

16S rRNA

GCAAGCYTAACACATGCAAGTCG

CTACTAGGTAGATTCCTAYGCATTACTCACC

0.5

102b

[11]

Piroplasmid

18S rRNA

GACGATCAGATACCGTCGTAGTCC

CAGAACCCAAAGACTTTGATTTCTCTC

0.3

114b

VetGenomic In-house design

Rickettsia spp.

ITS1

GCTCGATTGRTTTACTTTGCTGTGAG

CATGCTATAACCACCAAGCTAGCAATAC

0.5/0.3

300b

[11]

Bartonella spp.

ITS1

AGATGATGATCCCAAGCCTTCTG

CCTCCGACCTCACGCTTATCA

0.3

180b

Modified from [12] and [13]

Hemotropic Mycoplasma spp.

16S

GGAATCACTAGTAATCCYGTGTCAGCTATAT

GGCGGTGTGTACAAGCCTGG

0.3

187b

[14]

aThe eukaryotic 18S RNA Pre-Developed TaqMan Assay Reagents (AB, Life technologies) was used as an internal reference for genomic DNA amplification to ensure the proper PCR amplification of each sample. bTargeted size could vary depending on the species

Results

Results of tick species identification, season of collection, number, gender and feeding status in female ticks are listed in Table 2.
Table 2

Tick species identified, season of collection, number, gender and feeding status of ticks

Tick species and season of collection

Number of male ticks (%)

Number of female ticks (%) [% of ticks engorged]

Total

Ixodes ventalloi a,b,d

12 (19)

50 (81) [88]

62

Ixodes ricinus a,b,d

13 (65)

7 (35) [100]

20

Ixodes spp.a,b,d

0 (0)

5 (100) [100]

5

Rhipicephalus sanguineus sensu latob,c

14 (50)

14 (50) [42,8]

28

Rhipicephalus pusillus b,c

17 (100)

0 (0) [0]

17

TOTAL

56 (42)

76 (58) [81,5]

132

aWinter; bSpring; cSummer; dAutumn. No male tick was engorged

Majority of ticks (n = 128) were removed from 18 % (35/190) of cats evaluated at Lipari, with a range of 1–22 ticks/cat. In Calabria, ticks were collected from 2 out of 118 cats only (1.7 %). Three R. sanguineus s.l. tick specimens were removed from a cat in Reggio Calabria and one I. ricinus tick from a cat living in Gioia Tauro.

Different tick species of the same genus were frequently collected from a single cat. Three cats, sampled between March and May, were infested by both Rhipicephalus and Ixodes ticks. One of these latter cats was found infested by all four tick species detected in this study.

The tick positivity rate to at least one pathogen (Bartonella spp., Rickettsia spp., Ehrlichia/Anaplasma spp., Piroplasmid and L. infantum) was 14.4 % (19/132 ticks) (Table 3). This positivity rate was respectively 8.9 % in male (5/56) and 18.4 % in female (14/76) ticks. Moreover, 2 out of 13 non-engorged female ticks (15.3 %) and 10 out of 63 engorged female ticks (15.8 %) were positive to at least one pathogen.
Table 3

Pathogen PCR results and GenBank ID sequences according to tick species

 

Number of positive ticks to any pathogen/ numbers of ticks studied (%)

 

PCR pathogens

I. ventalloi

R. sanguineus sensu lato

R. pusillus

I. ricinus

Ixodes spp.

Ticks total (%)

GenBank ID sequences

Bartonella clarridgeiae

1/62 (1.6 %)

1/28 (3.5 %)

0 (0 %)

0 (0 %)

0 (0 %)

2/132 (1.5 %)

emb|FN645454.1|

Hemotropic Mycoplasma spp.

0 (0 %)

0 (0 %)

0 (0 %)

0 (0 %)

0 (0 %)

0/132 (0 %)

NA

Rickettsia spp.

1/62 (1.6 %)a

2/28 (7.1 %)

0 (0 %)

2/20 (10 %)

2/5 (40 %)

7/132 (5.3 %)

ND

Rickettsia monacensis

1 (1.6 %)

2 (7.1 %)

0 (0 %)

1 (5 %)

1 (20 %)

5 (3.8 %)

gb|KF016136.1|

Rickettsia helvetica

1 (1.6 %)

0 (0 %)

0 (0 %)

1 (5 %)

1 (20 %)

3 (2.3 %)

gb|JQ796866.1|

Ehrlichia spp. /Anaplasma spp.

1/62 (1.6 %)

0 (0 %)

0 (0 %)

0 (0 %)

0 (0 %)

1/132 (0.75 %)

Ehrlichia canis KF034789.1

Babesia vogeli

0 (0 %)

1/28 (3.5 %)

0 (0 %)

0 (0 %)

0 (0 %)

1/132 (0.75 %)

JX871885.1

Hepatozoon felis

0 (0 %)

0 (0 %)

0 (0 %)

0 (0 %)

0 (0 %)

0/132

ND

Leishmania infantum

4/62 (6.4 %)b

3/28 (10.7 %)c

3/17 (17.6 %)

1/20 (10 %)

0 (0 %)

11/132 (8.3 %)

ND

Total number of positive ticks to any pathogen/total numbers of ticks studied (%)

6/62 (9.7 %)

5/28 (17.8 %)

3/17 (17.6 %)

3/20 (15.0 %)

2/5 (40.0 %)

19/132 (14.4 %)

NA

aOne tick was co-infected with R. monacensis and R. helvetica; bone female tick co-infected with B. clarridgeiae. cOne male tick coinfected with B. vogeli and one female tick co-infected with R. monacensis. NA not applicable, ND not determined

No significant differences were found between positivity at least to one pathogen and tick genus, engorgement of females and gender.

Leishmania infantum DNA was found in 11 ticks (seven females and four males) and the median Leishmania parasite load was 200 parasites/specimen (range 17–555 Leishmania/specimen).

Discussion

In the present study, active adult ticks were found on cats during all seasons in all sites of collection. However, almost all ticks were found on cats from Lipari (Eolian Archipelago). Interestingly, I. ventalloi, I. ricinus, R. sanguineus s.l. and R. pusillus ticks were collected from cats. There are no published data on ticks removed from cats in Sicily and Calabria but Rhipicephalus spp. ticks were the only tick species removed from dogs and represented the most prevalent ticks in Sicily [15]. Ecological factors, season of tick sampling, climatic variations and host preferences may be responsible for the differences observed. In Northwestern Italy, R. sanguineus s.l. was found in 86.5 % of infested dogs and 26.3 % of infested cats while I. ricinus infested 18.5 % of dogs and 68.4 % of cats [16]. Ixodes ricinus ticks were the most common ticks found on cats in Europe as north as the Artic Circle and this is one of the southernmost finding of these ticks in Europe [1720]. Migrating birds are considered dispersal agents of larval stages of I. ricinus and they could contribute to the presence of this tick species in the studied areas which are stop-over and nesting sites of migratory birds moving from Africa to Central-Northern Europe [21].

Ixodes ventalloi ticks were the most prevalent tick species removed from cats in Lipari (48 % of tick specimens collected in this site) and for the first time it was found PCR positive to L. infantum. The so-called “rabbit tick” is scarcely reported on dogs and cats and it is usually found on wild mammals (rabbit, fox, hedgehog, etc.) as well as on birds [19, 22]. We think that the presence of I. ventalloi in cats from Lipari is due to the abundance of wild rabbits (Oryctolagus cuniculus) in the island (Piano Faunistico-Venatorio della Regione Siciliana, 2013–2018).

This faunal peculiarity in Lipari Island can also explain our finding of R. pusillus which is also typical of wild rabbits but it may be found in dogs and other domestic or wild mammals [2224]. This is the first bona fide report of R. pusillus from cats in Italy where this tick has been identified in rabbits and in a hedgehog [23, 24]. Outdoor cats, as predators of bunnies or birds, may particularly be exposed to infestation from ectoparasites of their pray and act as a link between wildlife and synanthropic habitats. Recently, R. pusillus was also removed from human patients in Italy [25] and this tick species was found positive to Mediterranean spotted fever (MSF) group Rickettsiae [24]. Interestingly, in the present study, R. pusillus was found for the first time PCR positive to L. infantum.

In the present study, we added new data about the vectorial potential of I. ventalloi as we found a tick DNA positive for both R. helvetica and R. monacensis and some other positive for B. clarridgeiae, E. canis and L. infantum. Moreover, we detected for the first time R. monacensis, B. clarridgeiae and B. vogeli DNA in R. sanguineus s.l. ticks removed from cats.

Finally, we confirmed that co-infections are quite common in ticks and may be responsible for polimicrobial infections in susceptible hosts [19, 25]. In fact, we observed the presence of DNA of different pathogens (B. vogeli, R. monacensis, B. clarridgeiae) in three ticks (I. ventalloi and R. sanguineus s.l.) positive to L. infantum which was the most prevalent pathogen DNA found in this study while one I. ventalloi harbored both R. monacensis and R. helvetica.

In conclusion, the present study provides new data on ticks collected from cats and associated pathogens. Effective preventative measures against tick infestations should be strongly recommended to pet cat owners all year around in the South of Italy.

Notes

Abbreviations

Bp: 

Base pairs

DNA: 

Deoxyribonucleic acid

MSF: 

Mediterranean spotted fever

OR: 

Odds ratio

PCR: 

Polymerase chain reaction

VBPs: 

Vector borne pathogens

Declarations

Acknowledgements

The authors are grateful to Tatiana Proboste for helping with morphological identification of ticks.

This clinical study was completely funded by Bayer Animal HealthCare-Animal Health Division (Monheim, Germany). Publication fees of this manuscript have been sponsored by Bayer HealthCare - Animal Health division.

Dr. Laia Solano-Gallego holds a Ramón y Cajal senior researcher contract awarded by the Ministerio de Ciencia e Innovación and the European Social Fund.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Dipartimento di Scienze Veterinarie, Università di Messina, Polo Universitario Annunziata
(2)
Dottorato di Ricerca Scienze Mediche Veterinarie, Università di Messina, Polo Universitario Annunziata
(3)
Vetgenomics, Edifici Eureka, PRUAB
(4)
Istituto Zooprofilattico Sperimentale della Sicilia, A. Mirri, Via G. Marinuzzi 3
(5)
Veterinary practitioner, Via F. Crispi 56
(6)
Departament de Medicina i Cirurgia Animals. Facultat de Veterinaria, Universitat Autonoma de Barcelona. Bellaterra

References

  1. Otranto D, Dantas-Torres F. Canine and feline vector-borne diseases in Italy: current situation and perspectives. Parasites & Vectors. 2010;3:2.View ArticleGoogle Scholar
  2. Dantas-Torres F, Chomel BB, Otranto D. Ticks and tick-borne diseases: a One Health perspective. Trends Parasitol. 2012;28(10):437–46.View ArticlePubMedGoogle Scholar
  3. Beninati T, Genchi C, Torina A, Caracappa S, Bandi C, Lo N. Rickettsiae in Ixodid Ticks. Sicily Emerg Infect Dis. 2005;11(3):509–11.View ArticlePubMedGoogle Scholar
  4. Dantas-Torres F, Otranto D. Species diversity and abundance of ticks in three habitats in southern Italy. Ticks Tick Borne Dis. 2013;4(3):251–5.View ArticlePubMedGoogle Scholar
  5. Manilla G. Vol. XXXVI di Fauna D’Italia. Acari: Ixodida. Bologna: Ed. Calderini; 1998.Google Scholar
  6. Estrada-Peña A, Bouattour A, Camicas JL, Walker AR: Ticks of Domestic Animals in the Mediterranean Region: A Guide to Identification of Species, Zaragoza, Spain: Edited by University of Zaragoza; 2004Google Scholar
  7. Bristol University Tick ID [http://bristoltickid.blogs.ilrt.org/]
  8. Solano-Gallego L, Rossi L, Scroccaro AM, Montarsi F, Caldin M, Furlanello T, et al. Detection of Leishmania infantum DNA mainly in Rhipicephalus sanguineus male ticks removed from dogs living in endemic areas of canine leishmaniosis. Parasites & Vectors. 2012;5:98.View ArticleGoogle Scholar
  9. Vitale F, Caracappa S, Manna L, Gravino AE, Reale S: Leishmania infantum minicircle DNA sequencing analysis and diagnosis by PCR. In Proceedings of the Second World Congress on Leishmaniasis (WL2) 2001, Creta, 2001Google Scholar
  10. Vitale F, Reale S, Vitale M, Petrotta E, Torina A, Caracappa S. TaqMan-Based Detection of Leishmania infantum DNA using canine samples. Ann N Y Acad Sci. 2004;1026:139–43.View ArticlePubMedGoogle Scholar
  11. Cabello J, Altet L, Napolitano C, Sastre N, Hidalgo E, Dávila A, et al. Survey of infectious agents in the endangered Darwin’s fox (Lycalopex fulvipes): high prevalence of diversity of hemotrophic mycoplasmas. Vet Microbiol. 2013;167(3–4):448–54.View ArticlePubMedGoogle Scholar
  12. Maggi RG, Harms CA, Hohn AA, Pabst DA, McLellan WA, Walton WJ, et al. Bartonella henselae in porpoise blood. Emerg Infect Dis. 2005;11(12):1894–8.PubMed CentralView ArticlePubMedGoogle Scholar
  13. Gil H, García-Esteban C, Barandika JF, Peig J, Toledo A, Escudero R, et al. Variability of Bartonella genotypes among small mammals in Spain. Appl Environ Microbiol. 2010;76(24):8062–70.PubMed CentralView ArticlePubMedGoogle Scholar
  14. Martínez-Díaz VL, Silvestre-Ferreira AC, Vilhena H, Pastor J, Francino O, Altet L. Prevalence and co-infection of haemotropic mycoplasmas in Portuguese cats by real-time polymerase chain reaction. J Feline Med Surg. 2013;15(10):879–85.View ArticlePubMedGoogle Scholar
  15. Brianti E, Pennisi MG, Brucato G, Risitano AL, Gaglio G, Lombardo G, et al. Efficacy of the fipronil 10 % + (S)-methoprene 9 % combination against Rhipicephalus sanguineus in naturally infested dogs: speed of kill, persistent efficacy on immature and adult stages and effect of water. Vet Parasitol. 2010;170(1–2):96–103.View ArticlePubMedGoogle Scholar
  16. Manfredi MT, Dini V, Piacenza S, Genchi C. Tick species parasitizing people in an area endemic for tick-borne diseases in north-western Italy. Parassitologia. 1999;41(4):555–60.PubMedGoogle Scholar
  17. Claerebout E, Losson B, Cochez C, Casaert S, Dalemans AC, De Cat A, et al. Ticks and associated pathogens collected from dogs and cats in Belgium. Parasites & Vectors. 2013;6:183.View ArticleGoogle Scholar
  18. Capári B, Hamel D, Visser M, Winter R, Pfister K, Rehbein S. Parasitic infections of domestic cats, Felis catus, in western Hungary. Vet Parasitol. 2013;192(1–3):33–42.View ArticlePubMedGoogle Scholar
  19. Jameson LJ, Medlock JM. Tick surveillance in Great Britain. Vector Borne Zoonotic Dis. 2011;11(4):403–12.View ArticlePubMedGoogle Scholar
  20. Hvidsten D, Stuen S, Jenkins A, Dienus O, Olsen RS, Kristiansen BE, et al. Ixodes ricinus and Borrelia prevalence at the Arctic Circle in Norway. Ticks Tick Borne Dis. 2014;5(2):107–12.View ArticlePubMedGoogle Scholar
  21. Falchi A, Dantas-Torres F, Lorusso V, Malia E, Lia RP, Otranto D. Autochthonous and migratory birds as a dispersion source for Ixodes ricinus in southern Italy. Exp Appl Acarol. 2012;58(2):167–74.View ArticlePubMedGoogle Scholar
  22. Santos-Silva MM, Beati L, Santos AS, De Sousa R, Núncio MS, Melo P, et al. The hard-tick fauna of mainland Portugal (Acari: Ixodidae): An update on geographical distribution and known associations with hosts and pathogens. Exp Appl Acarol. 2011;55(1):85–121.View ArticlePubMedGoogle Scholar
  23. Satta G, Chisu V, Cabras P, Fois F, Masala G. Pathogens and symbionts in ticks: a survey on tick species distribution and presence of tick transmitted micro-organisms in Sardinia, Italy. J Med Microbiol. 2011;60:63–8.View ArticlePubMedGoogle Scholar
  24. Ciceroni L, Pinto A, Rossi C, Khoury C, Rivosecchi L, Stella E, et al. Rickettsiae of the spotted fever group associated with the host-parasite system Oryctolagus cuniculi/Rhipicephalus pusillus. Zentralbl Bakteriol Mikrobiol Hyg A. 1988;269(2):211–7.PubMedGoogle Scholar
  25. Otranto D, Dantas-Torres F, Giannelli A, Latrofa MS, Cascio A, Cazzin S. Ticks infesting humans in Italy and associated pathogens. Parasites & Vectors. 2014;7(1):328.View ArticleGoogle Scholar

Copyright

© Pennisi et al. 2015

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Advertisement