Open Access

Molecular detection of Leishmania infantum and Leishmania tropica in rodent species from endemic cutaneous leishmaniasis areas in Morocco

  • Mohamed Echchakery1Email author,
  • Carmen Chicharro2,
  • Samia Boussaa1, 3,
  • Javier Nieto2,
  • Eugenia Carrillo2,
  • Ortega Sheila2,
  • Javier Moreno2 and
  • Ali Boumezzough1
Parasites & Vectors201710:454

https://doi.org/10.1186/s13071-017-2398-8

Received: 26 January 2017

Accepted: 21 September 2017

Published: 2 October 2017

Abstract

Background

Leishmaniasis remains a major public health problem in African nations, including Morocco, where little is known about the vertebrate reservoirs involved in the causal parasites’ transmission cycles. The present study investigates the role of rodent species as potential reservoirs of Leishmania spp. in central Morocco, where both L. tropica and L. infantum have been reported.

Methods

Rodents were caught from 22 sites in central Morocco, by using Sherman metal traps, and identified morphologically. For each specimen, genomic DNA was extracted from different tissues using the Speed Tools DNA extraction Kit. Then, samples were PCR-analyzed, targeting the SSU rRNA gene to detect Leishmania spp. DNA, followed by amplification of the internal transcribed spacer 1 (ITS1) and its sequencing to identify the species.

Results

A total of 197 rodents belonging to ten species were captured and identified: Rattus rattus (40.61%), Mus musculus (25.38%), Apodemus sylvaticus (8.63%), Mus spretus (7.11%), Meriones shawi (5.58%), Rattus norvegicus (4.57%), Meriones libycus (3.05%), Mastomys erythroleucus (2.03%), Gerbillus campestris (2.03%) and Lemniscomys barbarus (1.01%). Molecular analysis revealed the presence of Leishmania species in 18 specimens: six R. rattus (out of 80 captured; 7.5%), 11 M. musculus (out of 50 captured; 22%), and one R. norvegicus (out of 9 captured; 11.11%).

Conclusions

To the best of our knowledge, L. infantum and L. tropica were identified in rodent species for the first time in Morocco. These findings suggest that rodent species may be involved in L. infantum and L. tropica transmission cycles in this country but that further studies are needed to confirm their role as reservoirs of Leishmania species in Morocco.

Keywords

Leishmania tropica L. infantum LnPCR ITS1 PCR Rodents Morocco

Background

Leishmaniasis is a vector-borne infectious disease caused by members of the genus Leishmania (Kinetoplastida: Trypanosomatidae) and transmitted by phlebotomine sand flies (Diptera: Psychodidae) [1]. In the Mediterranean basin, the primary reservoir hosts of Leishmania spp. are wild mammals, mainly rodents and canids [25].

Leishmaniasis remains one of the major public health problems in Morocco where three Leishmania species coexist [6]. Leishmania infantum causes mainly zoonotic visceral leishmaniasis; L. major causes zoonotic cutaneous leishmaniasis and L. tropica causes anthroponotic cutaneous leishmaniasis [6]. Certainly, natural Leishmania infections have been reported in many rodent species, such as Mus musculus, Rattus norvegicus, Rattus rattus and Apodemus sylvaticus [717]. However, in Morocco, the only proven rodent reservoir of Leishmania (L. major MON 25) is Meriones shawi (Rodentia: Gerbillidae) [18, 19], despite the country being rich in rodent species [20].

The detection of infection in wild and domestic animals is the first step in identifying the different host reservoirs of Leishmania spp. Host incrimination depends on the accumulation of evidence based on five criteria [21, 22]: (i) geographical and temporal overlapping of vectors and hosts distributions; (ii) survival of the reservoir host long enough to permit transmission; (iii) higher infection prevalence; (iv) presence and frequency of parasites in the skin or the blood to be infective for the vector; and (v) detection of the same Leishmania species in human cases and the reservoir host.

In the present work, molecular methods were used to detect Leishmania infection in wild-caught rodents from central Morocco, from where both cutaneous and visceral leishmaniasis has been reported in humans [17, 23].

Methods

Study area

This study was conducted in four regions of central Morocco: Al Haouz, Chichaoua, Essaouira and Marrakesh. A total of 22 sites (Fig. 1) with altitudes between 318 and 2579 m were sampled. Across the study area, the climate is arid to semi-arid on the plain (up to 450 m in Marrakesh) and humid in the Atlas Mountains (right up to 4167 m on Toubkal Mountain) and on the coast (up to 50 m in Essaouira).
Fig. 1

Local map showing the study area. Numbers (1–22) indicate sampling sites

Rodent collection

The presence of rodents was surmised from cut plant stems and fresh droppings. Animals were captured using metal Sherman baited traps placed at the entrances of active burrows. For catching many rodent species, different baits were used in the same trap: bread with olive oil, tomatoes, potatoes and dates. The traps were set in the afternoon and recovered early the next morning. Forty traps were placed twice monthly (every 15 days) at each site between June 2014 and May 2015.

Treatment of captured rodents and DNA extraction

In the laboratory, caught rodents were anaesthetized with ether for the purposes of species identification and collecting data on weight, length (body and tail) and skin lesions (according to European decree NOR: AGRG1238767A 2013). Species identifications were made according to morphological characteristics [24]. Samples of liver, spleen, bone marrow and skin (ear lobe and, when available, skin lesions) (Fig. 2) were then harvested for parasite detection.25–30 mg of each tissue was removed with the aid of single-use forceps, scissors and scalpel blades, placed in sterile tubes, and stored at -20 °C for DNA extraction.
Fig. 2

Skin lesions in rodent specimens

Genomic DNA was extracted using the Speed Tools DNA extraction Kit (Biotools, Madrid, Spain) following the manufacturer’s recommendations, and was eluted in a final volume of 200 μl of PCR-grade water. The extracts were stored at 4 °C until PCR analysis.

Detection of Leishmania spp. DNA

The extracted DNA was screened for Leishmania spp. by the LnPCR amplifying a fragment from the small subunit ribosomal ribonucleic acid gene SSU rRNA [25, 26]. The first amplification step (Table 1) was performed using R221 (specific for order Kinetoplastida) and R332 primers (specific for the genera Leishmania and Crithidia) [25]. The PCR product was then tested in a subsequent amplification step with R233 and R333 primers of the genus Leishmania, according to the protocol developed by Van Eys et al. [25] and adapted and modified by Cruz et al. [27].
Table 1

PCR methods and primers sequences and main conditions used in this study

Gene

Primer

Product size (bp)

Primer sequence (5′-3′)

Amplification conditions

H2O (μl)a

MgCl2 (μl)

dNTP (0.2 mM) (μl)

Primer (μl)

Units Taq DNA polymerase (μl)

DNA (μl)

Total volume (μl)

SSU

R221

603

GGTTCCTTTCCTGATTTACG

94 °C for 5 min, 94 °C for 30s, 60 °C for 30s, 72 °C for 30s, 72 °C for 5 min (30 cycles)

30.6

5.0

1.0

1.0 (15 pmol)

1.4 (1 U/μl)

10

50

R332

GGCCGGTAAAGGCCGAATAG

R223

358

TCCCATCGCAACCTCGGTT

94 °C for 5 min, 94 °C for 30s, 65 °C for 30s, 72 °C for 30s, 72 °C for 5 min (30 cycles)

10.6

2.5

0.5

0.5 (7.5 pmol)

0.7 (0.5 U/μl)

10a

25

R333

AAAGCGGGCGCGGTGCTG

0. 25 (3.75 pmol)

ITS1

LITSR

300–350

CTGGATCATTTTCCGATG

94 °C for 5 min, 94 °C for 30s, 53 °C for 30s, 72 °C for 30s, 72 °C for 5 min (30 cycles)

30.6

5.0

1.0

1.0 (15 pmol)

1.4 (1 U/μl)

10

50

L5.8S

TGATACCACTTATCGCACTT

SAC

280–330

CATTTTCCGATGATTACACC

94 °C for 5 min, 94 °C for 30s, 57 °C for 30s, 72 °C for 30s, 72 °C for 5 min (30 cycles)

10.6

2.5

0.5

0.5 (7.5 pmol)

0.7 (0.5 U/μl)

10b

25

VAN2

CGTTCTTCAACGAAATAGG

aSterile distilled water

b10 μl of a 1/40 dilution of the first PCR amplicons

A reamplification reaction was then performed in a 25 μl final volume, involving 10 μl of a 1/40 dilution of the first PCR amplicons as a template was added to a PCR mixture (Table 1). The components, total reaction volume and programs for the implementation of the LnPCR are detailed in Table 1. The amplification products were resolved on a 1.5% agarose gel, stained with Gel Red Nucleic Acid stain (Biotium, Fremont, California, USA), and visualized under UV light. Samples yielding a PCR product of 603 bp (Additional file 1: Figure S1) and 358 bp (Additional file 1: Figure S2), respectively, by first and second amplification reaction were deemed positive for Leishmania spp. DNA.

Negative controls without DNA were employed in all assays. DNA from the reference Leishmania infantum strain MHOM/FR/78/LEM75 was used as a positive control (Additional file 1: Figures S1-S3).

Identification of Leishmania species

Samples shown to be positive by LnPCR were further analyzed to identify the Leishmania species by nested amplification of the ribosomal internal transcribed spacer 1 (ITS1-PCR).

The first PCR reaction was carried out using the primers LITSR/L5.8S as described by El Tai et al. [28] and Schönian et al. [29]. Amplification reactions were performed in volumes of 50 μl was added to a PCR mixture described in Table 1. For the second reaction, we used the primers SAC and VAN2 [30]. A reamplification reaction was then performed in a 25 μl final volume, involving 10 μl of a 1/40 dilution of the first PCR amplicons as a template was added to a PCR mixture described in Table 1.

Negative and positive controls were also included in this assay. All reactive were synthesized commercially (Biotools, B&M Labs, S.A., Madrid, Spain). All PCR products were visualized on 1.5% agarose gel as above (Additional file 1: Figure S3). Samples providing a 300–350 bp (Additional file 1: Figure S2) and 280–330 bp (Additional file 1: Figure S3), respectively, were deemed positive. The ITS1-PCR products were excised from the agarose gels and purified using the QIA quick extraction kit (Qiagen). They were then sequenced which allows to correctly identify all species of the genus Leishmania of the Old World [31], using the Big-Dye Terminator Cycle Sequencing Ready Reaction kit v3.1 and an automated ABI PRISM 377 DNA sequencer (Applied Biosystems, Foster City, CA, USA). These sequences were edited using BioEdit Sequence Alignment Editor Software v. 7.0.9.0 [32] and compared with others held in the GenBank database using BLAST software.

Results

A total of 197 animals belonging to 10 rodent species were captured (Table 2): 80 Rattus rattus (40.61%), 50 Mus musculus (25.38%), 17 Apodemus sylvaticus (8.63%), 14 Mus spretus (7.11%), 11 Meriones shawi (5.58%), 9 Rattus norvegicus (4.57%), 6 Meriones libycus (3.05%), 4 Mastomys erythroleucus (2.03%), 4 Gerbillus campestris (2.03%) and 2 Lemniscomys barbarus (1.01%).
Table 2

Rodent species captured in the study area

Species

Male

Female

Total

%

Rattus rattus

28

52

80

40.61

Mus musculus

14

36

50

25.38

Apodemus sylvaticus

6

11

17

8.63

Mus spretus

6

8

14

7.11

Meriones shawi

5

6

11

5.58

Rattus norvegicus

4

5

9

4.57

Meriones libycus

1

5

6

3.05

Mastomys erythroleucus

1

3

4

2.03

Gerbillus campestris

2

2

4

2.03

Lemniscomys barbarus

0

2

2

1.01

Total

67

130

197

100

Leishmania species was detected in 18 specimens (Table 3): 6 R. rattus (out of 80 captured; 7.5%), 11 M. musculus (out of 50 captured; 22%), and one R. norvegicus (out of 9 captured; 11.11%). Statistical analysis, using Chi-square test of independence, of infestation rate according to rodent species showed no significant correlation (χ 2 = 5.768, df = 2, P = 0.056).
Table 3

Molecular identification of Leishmania species from rodent species by tissue/organ

Rodent species and number of specimens

LnPCR

ITS1-PCR

Leishmania spp.

Identity (%)

L

Sp

S

Sl

L

Sp

S

Sl

R. norvegicus (n = 1/9)

P

P

N

P

P

N

L. infantum

99

R. rattus (n = 6/80)

P

P

N

P

P

N

L. infantum

99

P

P

N

P

P

N

L. infantum

99

N

N

P

P

N

N

P

P

L. infantum

99

N

N

P

P

N

N

P

P

L. infantum

99

N

N

P

N

N

P

L. infantum

98

N

N

P

N

N

P

L. infantum

99

M. musculus (n = 9/50)

N

N

P

N

N

P

L. infantum

98

N

N

P

N

N

P

L. infantum

99

N

N

P

N

N

P

L. infantum

98

N

N

P

N

N

P

L. infantum

99

N

N

P

N

N

P

L. infantum

99

N

N

P

N

N

P

L. infantum

100

N

N

P

P

N

N

P

P

L. infantum

99

N

N

P

P

N

N

P

P

L. infantum

99

N

N

P

P

N

N

P

P

L. infantum

99

M. musculus (n = 2/50)

N

N

P

N

N

P

L. tropica

96

N

N

P

N

N

P

L. tropica

97

Abbreviations: L Liver, S Skin, Sl Skin lesion, Sp Spleen, N Negative, P Positive, –, absence of skin lesion

Leishmania infantum DNA was detected in the different organs of 16 (8.12%) specimens (Table 3): in the liver (18.75%) and the spleen (18.75%) of three specimens (n = 3), and in the skin (81.25%) of 13 specimens (n = 13). Leishmania tropica DNA was found only in the skin of 2 (1%) specimens (Additional file 1: Figures S1-S3).

According to the region, Leishmania spp. DNA was detected in 3 of the 4 investigated regions: Al Haouz, Chichaoua and Essaouira (Table 4); with a very significant difference (χ 2 = 20.116, df = 3, P < 0.0001). Leishmania infantum was detected in the Al Haouz region in 14.28% (3/21) of R. rattus, and in 46.15% (6/13) of M. musculus and L. tropica was identified in Chichaoua region in 14.28% (1/7) of M. musculus.
Table 4

Rodent species infected with Leishmania species by region

 

El Haouz

Chichaoua

Essaouira

Marrakesh

Neg

Pos

Neg

Pos

Neg

Pos

Neg

Pos

R. rattus

18

L. infantum

(14.28%)

12

0

14

L. infantum

(17.64%)

30

0

M. musculus

7

L. infantum

(46.15%)

6

L. tropica

(14.28%)

7

L. infantum (27.27%) + 1 L. tropica (9.10%)

19

0

R. norvegicus

0

0

0

0

2

L .infantum

(33.33%)

6

0

Abbreviations: Neg Negative, Pos Positive

Both Leishmania species were detected in Essaouira region: L. infantum was identified in 17.64% (3/17) of R. rattus, in 33.33% (1/3) of R. norvegicus, and in 27.27% (3/11) of M. musculus; while, L. tropica was identified in 9.10% (1/11) of M. musculus. In Marrakesh region, no Leishmania spp. DNA was detected in any of the 55 animals captured (Table 4).

Ten animals showed ear lobe skin lesions (Fig. 2), of which 50% were confirmed positive for L. infantum. Three of these positive animals showed, in addition, splenomegaly and hepatomegaly (compatible with visceral leishmaniasis).

Discussion

The identification of the natural hosts of Leishmania species is essential to understand the epidemiology of the disease. To our knowledge, there have been no data published since 1982 on natural Leishmania infection in rodent species in Morocco [19].

In the present study, L. infantum DNA was detected in six R. rattus, nine M. musculus (both anthropophilic species) and one R. norvegicus, while L. tropica DNA was detected in two M. musculus. This is the first time that L. infantum and L. tropica infections have been detected in rodent species in Morocco. In the wider Mediterranean region, L. infantum (which causes visceral and cutaneous zoonotic leishmaniasis) has been identified in naturally infected wild rodents including R. rattus, R. norvegicus and M. musculus [8, 10, 12, 15, 16, 3335]. In Morocco, dogs make up the main host reservoir for L. infantum [17, 36]. However, on the Island of Montecristo (Italy), where no dogs are present, up to 15.5% of R. rattus individuals have been reported infected with L. infantum [37], maintaining a sylvatic transmission cycle.

Leishmania tropica-induced cutaneous leishmaniasis is commonly considered an anthroponotic disease that does not involve an animal reservoir [38], but zoonotic transmission has been demonstrated in Jordan, Palestine and Israel [39, 40].

In north Africa, several rodent species have been implicated in the transmission of L. tropica [3942]: Ctenodactylus gundi has been proposed as a reservoir host in Tunisia [42, 43], while in Algeria, human cutaneous leishmaniasis caused by Leishmania killicki (a variant of L. tropica) is considered a zoonotic form with P. sergenti as a vector and Massoutiera mzabi as a reservoir [39]. However, in Morocco L. tropicais generally considered an anthroponotic species, despite its identification in dogs on many occasions [4446].

In the present study, the regions of Chichaoua, Al Haouz and Essaouira were known to be endemic foci of L. tropica-induced cutaneous leishmaniasis for humans [4749], while, L. infantum is reported responsible for sporadic human cases of visceral leishmaniasis in these areas [50, 51]. In the same study area, Boussaa et al. [23] reported L. infantum-induced leishmaniasis in dogs, which returned very high seroprevalence results (81.8 and 87.8% as determined by ELISA and Western blotting, respectively).

In addition, the vector sand flies Phlebotomus perniciosus and P. sergenti have been found engorged with rodent blood in southern Portugal [52] but also in central Morocco [53] where the sand fly composition is well established [54]. Svobodovà et al. [55] reported the transmission of L. tropica to mice by the bite of Phlebotomus sergenti, a species widespread in our study area [54].

The richness of rodent species (n = 10) across the present study area is favoured by ecological factors. Prevalence and abundance of rodent species areknown to be associated with abundant vegetation [56]. In arid and semi-arid regions, such in the study area, many authors suggested trophic cascade including precipitations, vegetation and rodent density 1 year later [57, 58].

Conclusion

To the best of our knowledge, molecular detection of L. infantum DNA in M. musculus, R. norvegicus and R. rattusand of L. tropica DNA in M. musculus is reported here for the first time in Morocco. These results suggest the possible involvement of rodent species in L. tropica and L. infantum cycles. The present findings should be taken into consideration when developing programs to combat this disease in Morocco.

Abbreviations

ELISA: 

Enzyme-linked immunosorbent assay

ITS1: 

Internal transcribed spacer 1

LnPCR: 

Leishmania nested polymerase chain reaction

MM: 

Molecular marker

MON: 

Leishmania major Montpellier

SSU rRNA: 

Small subunit ribosomal ribonucleic acid

Tth: 

Thermus thermophilus

WHO: 

World Health Organization

Declarations

Acknowledgements

The authors would like to thank the staff members of the Laboratory of Ecology and Environment, Faculty of Sciences, Semlalia, Cadi Ayyad University, Morocco and Parasitology Service of National Center of Microbiology, Institute of Health Carlos III, Majadahonda, Madrid, Spain; for hosting and supporting the study.

Funding

Not applicable.

Availability of data and materials

The data supporting the conclusions of this article are provided within the article. Representative sequences were submitted to the GenBank database under the accession numbers: L. infantum ex M. musculus (MF977313), ex R. norvegicus (MF977315), ex R. rattus (MF977314); L. tropica ex M. musculus (MF977312).

Authors’ contributions

ME, SB and AB conceived the project, and were involved in capturing and rodent identification, conducting literature searches and analysis of the results, and participated in the writing of the manuscript. ME, CC, JN, EC, OS and JM were involved in the molecular diagnostics (DNA extraction and PCR) of Leishmania. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All animals were treated according to European decree NOR: AGRG1238767A (1st February 2013) regarding the ethical evaluation and authorization of projects involving animals for experimental procedures. All efforts were made to minimize the suffering of the animals used.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Ecology and the Environment Laboratory L2E, (URAC 32, CNRST ERACNERS 06), Faculty of Sciences Semlalia, Cadi Ayyad University
(2)
WHO Collaborating Centre for Leishmaniasis, Parasitology Service, National Center of Microbiology Institute of Health Carlos III
(3)
ISPITS-Higher Institute of Nursing and Technical Health Occupations, Ministry of Health

References

  1. Lainson R, Shaw JJ. Evolution, classification and geographical distribution. In: Peters W, Killick-Kendrick R, editors. The Leishmaniasis in Biology and Medicine. London: Academic Press; 1987.Google Scholar
  2. Pesson B, Ready JS, Benabdennbi I, Martin-Sanchez J, Esseghir S, Cadi Soussi M, et al. Sand flies of the Phlebotomus perniciosus complex: mitochondrial introgression and a new sibling species of P. longicuspis in the Moroccan Rif. Med Vet Entomol. 2004;18:25–37.View ArticlePubMedGoogle Scholar
  3. Gramiccia M, Gradoni L. The current status of zoonotic leishmaniases and approaches to disease control. Int J Parasitol. 2005;35(11–12):1169–80.View ArticlePubMedGoogle Scholar
  4. Ashford RW. Leishmaniasis reservoirs and their significance in control. Clin Dermatol. 1996;14:523–32.View ArticlePubMedGoogle Scholar
  5. Quinnell RJ, Courtenay O. Transmission, reservoir hosts and control of zoonotic visceral leishmaniasis. Parasitology. 2009;136(14):1915–34.View ArticlePubMedGoogle Scholar
  6. Kahime K, Boussaa S, Bounoua L, Ouanaimi F, Messouli M, Boumezzough A. Leishmaniasis in Morocco: diseases and vectors. Asian Pac J Trop Dis. 2014;4(2):S530–4.View ArticleGoogle Scholar
  7. El-Adhami B. Isolation of Leishmania from a black rat in the Baghdad area. Iraq Am J Trop Med Hyg. 1976;25:759–61.View ArticlePubMedGoogle Scholar
  8. Pozio E, Gradoni L, Bettini SE, Gramiccia M. Leishmaniasis in Tuscany (Italy) V. Further isolation of Leishmania from Rattus rattus in the Province of Grosseto. Ann Trop Med Parasitol. 1981;75:393–5.Google Scholar
  9. Gradoni L, Pozio E, Gramiccia M, Maroli M, Bettini S. Leishmaniasis in Tuscany (Italy): VII. Studies on the role of the black rat, Rattus rattus, in the epidemiology of visceral leishmaniasis. Trans R Soc Trop Med Hyg. 1983;77(4):427–31.View ArticlePubMedGoogle Scholar
  10. Giannini SH. Infection and detection of Leishmania infections in Rattus norvegicus. Trans R Trop Med Hyg. 1985;79:458–61.View ArticleGoogle Scholar
  11. Morillas-Márquez F, Benavides-Delgado I, González-Castro J, Reyes Agaña A, Valero-López A. Ocurrence of Leishmania spp. in Rattus rattus in the province of Granada. Ann Parasitol Hum Comp. 1985;60:768–70.View ArticleGoogle Scholar
  12. Ibrahim EA, Al-Zahrani MA, Al-Tuwaigri AS, Al-Shammary FJE, Evans DA. Leishmania infecting man and wild animals in Saudi Arabia. The black rat (Rattus rattus) a probable reservoir of visceral leishmaniasis in Gizan province, south-west Saudi Arabia. Trans R Soc Trop Med Hyg. 1992;86:513–4.View ArticlePubMedGoogle Scholar
  13. Di Bella C, Vitale F, Russo G, Greco A, Milazzo C, Aloise G, Cagnin M. Are rodents a potential reservoir for Leishmania infantum in Italy? J Mt Ecol. 2003;7:125–9.Google Scholar
  14. Mohebali M, Javadian E, Yaghoobi-Ershadi MR, Akhavan AA, Hajjaran H, Abaei MR. Characterization of Leishmania infection in rodents from endemic areas of the Islamic Republic of Iran. East Mediterr Health J. 2004;10(4–5):591–9.PubMedGoogle Scholar
  15. Motazedian MH, Parhizkari M, Mehrabani D, Hatam G, Asgari Q. First detection of Leishmania major in Rattus norvegicus from Fars Province. Southern Iran Vector Borne Zoonotic Dis. 2010;10(10):96975.Google Scholar
  16. Papadogiannakis E, Spanakos G, Kontos V, Menounos PG, Tegos N, Vakalis N. Molecular detection of Leishmania infantum in wild rodents (Rattus norvegicus) in Greece. Zoonoses Public Health. 2010;57(7–8):e23–5.View ArticlePubMedGoogle Scholar
  17. Helhazar M, Leitao J, Duarte A, Tavares L, Pereira da Fonseca I. Natural infection of synathropic rodent species Mus musculus and Rattus norvegicus by Leishmania infantum in Sesimbra and Sintra Portugal. Parasit Vectors. 2013;6:88.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Rioux JA, Petter F, Zahaf A, Lanotte G, Houin R, Jarry D, et al. [Isolation of Leishmania major Yakimoff and Shokhor. 1914 (Kinetoplastida-Trypanosomatidae) in Meriones shawi-shawi (Duvernoy. 1842) (Rodentia-Gerbillidae) in Tunisia]. Ann Parasitol Hum Comp. 1986;61(2):139–45 (In French).Google Scholar
  19. Rioux JA, Petter F, Akalay O, Lanotte G, Ouazani A, Seguignes M, Mohcine A. Meriones shawi (Duvernoy,1842) (Rodentia, Gerbillidae), reservoir of Leishmania major, Yakimoff & Schokhor, 1914 in South Morocco. C R Seances Acad Sci III. 1982;294(11):515–7.PubMedGoogle Scholar
  20. Echchakery M, Boussaa S, Kahime K, Boumezzough A. Epidemiological role of a rodent in Morocco: case of cutaneous leishmaniasis. Asian Pac J Trop Dis. 2015;5(8):589–94.View ArticleGoogle Scholar
  21. World Health Organization (WHO) Control of the Leishmaniasis. Report of a Meeting of the WHO Expert Committee on the Control of Leishmaniases. World Health Organization Technical Report Series No 949. Geneva: WHO; 2010.Google Scholar
  22. Silva ES, Gontijo CM, Melo MN. Contribution of molecular techniques to the epidemiology of Neotropical Leishmania species. Trends Parasitol. 2005;21(12):550–2.View ArticlePubMedGoogle Scholar
  23. Boussaa S, Kasbari M, El Mzabi A, Boumezzough A. Epidemiological investigation of canine leishmaniasis in southern Morocco. Adv Epidemiol. 2014;2014:104697.View ArticleGoogle Scholar
  24. Aulagnier S, Thévenot M. Catalogue of wild mammals in Morocco. Trav Inst Sci Rabat Sér Zool. 1986;41:1–163. (In French)Google Scholar
  25. Van Eys GJ, Schoone GJ, Kroon NC, Ebeling SB. Sequence analysis of small subunit ribosomal RNA genes and its use for detection and identification of Leishmania parasites. Mol Biochem Parasitol. 1992;51:133–42.View ArticlePubMedGoogle Scholar
  26. Meredith SEO, Zijlstra EE, Schoone GJ, Kroon CCM, Van Eys GJJM, Schaeffer KU, et al. Development and application of the polymerase chain reaction for the detection and identification of Leishmania parasites in clinical material. Arch Inst Pasteur Tunis. 1993;70:419–31.PubMedGoogle Scholar
  27. Cruz I, Cañavate C, Rubio JM, Morales MA, Chicharro C, Laguna F, et al. A nested polymerase chain reaction (Ln-PCR) for diagnosing and monitoring Leishmania infantum infection in coinfected patients with human immunodeficiency virus. Trans R Soc Trop Med Hyg. 2002;96:185–9.View ArticleGoogle Scholar
  28. El Tai NO, Osman OF, El Fari M, Presber W, Schönian G. Genetic heterogeneity of ribosomal internal transcribed spacer (ITS) in clinical samples of Leishmania donovani spotted on filter paper as revealed by single-strand conformation polymorphisms (sscp) and sequencing. Trans Royal Soc Trop Med Hyg. 2000;94:1–5.View ArticleGoogle Scholar
  29. Schonian G, Nasereddin A, Dinse N, Schweynoch C, Schallig HD, Presber W, Jaffe CL. PCR diagnosis and characterization of Leishmania in local and imported clinical samples. Diagn Microbiol Infect Dis. 2003;47:349–58.View ArticlePubMedGoogle Scholar
  30. Cruz I, Millet A, Carrillo E, Chenik M, Salotra P, Verma S, et al. An approach for interlaboratory comparison of conventional and real-time PCR assays for diagnosis of human leishmaniasis. Exp Parasitol. 2013;134:281–9.View ArticlePubMedGoogle Scholar
  31. Van der Auwera G, Bart A, Chicharro C, Cortes S, Davidsson L, Di Muccio T, et al. Comparison of Leishmania typing results obtained from 16 European clinical laboratories in 2014. EuroSurveill. 2016;21(49):30418.View ArticleGoogle Scholar
  32. Hall TA. Bio Edit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41:95–8.Google Scholar
  33. Portús M, Gállego M, Riera C, Aisa MJ, Fisa R, Castillejo S. Wild and domestic mammals in the life cycle of Leishmania infantum in Southwest Europe. A literature review and studies performed in Catalonia (Spain). Rev Iber Parasitol. 2002;62:72–6.Google Scholar
  34. Millán J, Ferroglio E, Solano-Gallego L. Role of wildlife in the epidemiology of infection in Europe. Parasitol Res 2014;113(6):2005–2014.Google Scholar
  35. Navea-Pérez HM, Díaz-Sáez V, Corpas-López V, Merino-Espinosa G, Morillas-Márquez F, Martín-Sánchez J. Leishmania infantum in wild rodents: reservoirs or just irrelevant incidental hosts? Parasitol Res. 2015;114(6):2363–70.View ArticlePubMedGoogle Scholar
  36. Rhajaoui M. Human leishmaniases in Morocco: a nosogeographical diversity. Pathol Biol. 2011;59(4):226–9. (In French)View ArticlePubMedGoogle Scholar
  37. Zanet S, Sposimo P, Trisciuoglio A, Giannini F, Strumia F, Ferroglio E. Epidemiology of Leishmania infantum, Toxoplasma gondii and Neospora caninum in Rattus rattus in absence of domestic reservoir and definitive hosts. Vet Parasitol. 2014;199(3–4):247–9.View ArticlePubMedGoogle Scholar
  38. Ashford RW. The leishmaniases as emerging and reemerging zoonoses. Int J Parasitol. 2000;30:1269–81.View ArticlePubMedGoogle Scholar
  39. Jacobson RL, Eisenberger CL, Svobodova M, Baneth G, Sztern J, Carvalho J, et al. Outbreak of cutaneous leishmaniasis in northern Israel. J Infect Dis. 2003;188:1065–73.View ArticlePubMedGoogle Scholar
  40. Talmi-Frank D, Jaffe CL, Nasereddin A, Warburg A, King R, Svobodova M, et al. Leishmania tropica in rock hyraxes (Procavia capensis) in a focus of human cutaneous leishmaniasis. Am J Trop Med Hyg. 2010;82:814–8.View ArticlePubMedPubMed CentralGoogle Scholar
  41. Boubidi SC, Benallal K, Boudrissa A, Bouiba L, Bouchareb B, Garni R, et al. Phlebotomus sergenti (Parrot, 1917) identified as Leishmania killicki host in Ghardaia, south Algeria. Microbes Infect. 2011;13(7):691–6.View ArticlePubMedGoogle Scholar
  42. Bousslimi N, Ben-Ayed S, Ben-Abda I, Aoun K, Bouratbine A. Natural infection of north African gundi (Ctenodactylus gundi) by Leishmania tropica in the focus of cutaneous leishmaniasis, Southeast Tunisia. Am J Trop Med Hyg. 2012;86(6):962–5.View ArticlePubMedPubMed CentralGoogle Scholar
  43. Jaouadi K, Haouas N, Chaara D, Gorcii M, Chargui N, Augot D, et al. First detection of Leishmania killicki (Kinetoplastida, Trypanosomatidae) in Ctenodactylus gundi (Rodentia, Ctenodactylidae), a possible reservoir of human cutaneous leishmaniasis in Tunisia. Parasit Vectors. 2011;4:159.View ArticlePubMedPubMed CentralGoogle Scholar
  44. Dereure J, Rioux JA, Gallego M, Perieres J, Pratlong F, Mahjour J, Saddiki H. Leishmania tropica in Morocco: infection in dogs. Trans R Soc Trop Med Hyg. 1991;85(5):595.View ArticlePubMedGoogle Scholar
  45. Guessous-Idrissi N, Riyad M, Chiheb S, Hamdam A, Hamdam S, Krimech A. La leishmaniose cutanée à Taza. Les Cahiers du Médecin. 1999;2:37–40.Google Scholar
  46. Lemrani M, Nejjar R, Pratlong F. A new Leishmania tropica zymodeme-causative agent of canine visceral leishmaniasis in northern Morocco. Ann Trop Med Parasitol. 2002;96:637–8.View ArticlePubMedGoogle Scholar
  47. Guernaoui S, Boumezzough A, Pesson B, Pichon G. Entomological investigations in Chichaoua: an emerging epidemic focus of cutaneous leishmaniasis in Morocco. J Med Entomol. 2005;42:697–701.View ArticlePubMedGoogle Scholar
  48. Boussaa S, Pesson B, Boumezzough A. Faunistic study of the sand flies (Diptera: Psychodidae) in an emerging focus of cutaneous leishmaniasis in Al Haouz Province, Morocco. Ann Trop Med Parasitol. 2009;103:73–83.Google Scholar
  49. Ajaoud M, Es-sette N, Hamdi S, El-Idrissi AL, Riyad M, Lemrani M. Detection and molecular typing of Leishmania tropica from Phlebotomus sergenti and lesions of cutaneous leishmaniasis in an emerging focus of Morocco. Parasit Vectors. 2013;6:217.View ArticlePubMedPubMed CentralGoogle Scholar
  50. Kahime K, Boussaa S, Ouanaimi F, Boumezzough A. Species composition of phlebotomine sand fly fauna in an area with sporadic cases of Leishmania infantum human visceral leishmaniasis, Morocco. Acta Trop. 2015;148:58–65.Google Scholar
  51. Moroccan Ministry of Health. A report on progress of control programs against parasitic diseases. Directorate of Epidemiology and Disease Control, Ministry of Health, Rabat, Morocco; 2014.Google Scholar
  52. Maia C, Dionísio L, Afonso MO, Neto L, Cristóvão JM, Campino L. Leishmania infection and host-blood feeding preferences of phlebotomine sand flies and canine leishmaniasis in an endemic European area, the Algarve Region in Portugal. Mem Inst Oswaldo Cruz Rio de Janeiro. 2013;108(4):481–7.View ArticleGoogle Scholar
  53. Ajaoud M, Es-Sette N, Charrel RN, Laamrani-Idrissi A, Nhammi H, Riyad M. Phlebotomus sergenti in a cutaneous leishmaniasis focus in Azilal Province (High Atlas, Morocco): Molecular detection and genotyping of Leishmania tropica, and feeding behavior. PLoS Negl Trop Dis. 2015;9(3):e0003687.View ArticlePubMedPubMed CentralGoogle Scholar
  54. Boussaa S, Kahime KM, Samy A, Ben Salem A, Boumezzough A. Species composition of sand flies and bionomics of Phlebotomus papatasi and P. sergenti (Diptera: Psychodidae) in cutaneous leishmaniasis endemic foci, Morocco. Parasit Vectors. 2016;9:60.View ArticlePubMedPubMed CentralGoogle Scholar
  55. Svobodovà M, Votypka J, Nicolas L, Volf P. Leishmania tropica in the black rat (Rattus rattus): persistence and transmission from asymptomatic host to sand fly vector Phlebotomus sergenti. Microbes Infect. 2003;5:361–4.View ArticlePubMedGoogle Scholar
  56. Aoun K, Bouratbine A. Cutaneous leishmaniasis in North Africa: a review. Parasite. 2014;21:14.View ArticlePubMedPubMed CentralGoogle Scholar
  57. Yates TL, Mills JN, Parmenter CA, Ksiazek TG, Parmenter RR, Vande Castle JR, et al. The ecology and evolutionary history of an emergent disease: Hantavirus pulmonary syndrome. Bioscience. 2002;52:989–98.View ArticleGoogle Scholar
  58. Bounoua L, Kahime K, Houti L, Blakey T, Ebi KL, Zhang P, et al. Linking climate to incidence of zoonotic cutaneous leishmaniasis (L. major) in pre-Saharan North Africa. Int J Environ Res Public Health. 2013;10(8):3172–91.View ArticlePubMedPubMed CentralGoogle Scholar

Copyright

© The Author(s). 2017

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Advertisement