Skip to main content

Table 1 Selected primer pairs and annealing temperature for the detection of mitochondrial target regions for the genera Babesia/Theileria, Anaplasma/Ehrlichia, Rickettsia and Borrelia

From: Molecular identification and prevalence of tick-borne pathogens in zebu and taurine cattle in North Cameroon

Genus Primer Target gene Primer sequence (5′-3′) Annealing T (°C) Amplicon size (bp) References
Babesia/Theileria RLB-F2 18S rDNA GACACAGGGAGGTAGTGACAAG 57 460–500 [12]
RLB-R2 CTAAGAATTTCACCTCTGACAGT
Anaplasma/Ehrlichia AnaEhr16S_f 16S rDNA AGAGTTTGATCMTGGYTCAGAA 55 460–520 This study
Ana-Ehr16S_r GAGTTTGCCGGGACTTYTTC
Rickettsia Rick-F1 16S rDNA GAACGCTATCGGTATGCTTAACACA 64 350–400 [13]
Rick-F2 CATCACTCACTCGGTATTGCTGGA
Borrelia outer 16S1A 16S rDNA CTAACGCTGGCAGTGCGTCTTAAG 63 1205 [14]
16S1B AGCGTCAGTCTTGACCCAGAAGTT
Borrelia inner 16S2A 16S rDNA AGTCAAACGGGATGTAGCAATAC 56 600–720 [14]
16S2B GTTATTCTTTCTGATATCAACAG
  1. Abbreviation: T, temperature