Skip to main content

Table 1 Information of microsatellite primers used for genotyping all the 17 Ae. albopictus populations

From: Dispersal patterns and population genetic structure of Aedes albopictus (Diptera: Culicidae) in three different climatic regions of China

No. Primer name Forward sequence (5′–3′) Reverse sequence (5′–3′) Repeat motifs Size range (bp) Dye GenBank no.
1 BW-P1 TTAGCATCCATCTATTCTGGC AAACATTCCTACGCATTTCAC (GT)6 230–260 5′-HEX MT642446
2 BW-P3 GAAAATATGGTCTATCAAATG AAGTCAGTAAAACAGGAGTCT (GT)3GC(GT)3TTT 132–178 5′-FAM MT642447
3 BW-P6 GAATTGGGAGCTTGGTAAAAC CGCCTACTTGAGAAACACTGA (TG)5 124–200 5′-HEX MT642448
4 BW-P18 CACTGGTTCTCTATCGAATGC GTGTTATCAGTTGGAAGCGTT (GT)24 158–203 5′-HEX MT642449
5 BW-P22 GGCGTCCCCCCAACATACATC CAGCTCCGTCCTCCTCTTCCC (GT)5(GCGT)2(GT)3 187–244 5′-HEX MT642450
6 BW-P23 GGATAAGAATGACACAGGCAC CAAAGAGGAACACCATAGGAA (GAC)7 133–177 5′-FAM MT642451
7 BW-P24 ACGAAACATACTTACAATTGCA AACCTAGAGTCCGAGAGAGAAC (AC)8 145–239 5′-FAM MT642452
8 BW-P26 CGTGGTGGTTAGGTCCATGTT TCGCTTTCGGCTCTAGTCAAT (GT)5 107–233 5′-HEX MT642453
9 BW-P27 TTATACAAAAAGCGAACATCC CACACACATAGAAAAAAGCAA (ACG)6 249–281 5′-FAM MT642454
10 BW-P35 TATTTGCACATCCATTTCGTCT TTCAAAACCTGATTTCCGACTG (CA)7TTT 83–120 5′-HEX MT642455
11 BW-P36 GTCATGTAGTCCTCACAGTCAC ATATGGATCATAGATGATGGAG (AC)6CCC 159–179 5′-FAM MT642456