Study site
This study was carried out in the municipality of Lages (27°48′57″S, 50°19′33″ W), Santa Catarina State, Brazil, which has a mixed rainforest terrain and altitude of 930 m above mean sea level.
The Köppen climate classification of the municipality is Cfb, i.e. it has a temperate oceanic climate. The average temperature in the coldest month is above 0 °C, the average annual temperature is below 22 °C, and at least 4 months have an average temperature above 10 °C, with no significant difference in precipitation between the seasons [21].
Sample collection
Tabanids were collected weekly from February 2018 to February 2019 from two rural properties located in different parts of the region in which especially cattle and horses are reared.
The collections were made once a week at the same location on each property, close to lakes and rivers, for 3 h, from 3 p.m. until 6 p.m., using a contained horse from each property as bait throughout the collection period. Tabanids that landed on the horses were carefully captured with a glass tube (4.5 cm diameter, 9 cm length) [14]. The flies were placed in individual plastic bottles using a SECTAB device [22]. The collected insects were transported to the Laboratory of Hemoparasites and Vectors (Lages, Santa Catarina, Brazil) and killed with chloroform in flasks.
Taxonomic identification of tabanids
Taxonomic identification was performed according to the taxonomic keys described by Fairchild and Philip [23], and Dr. Inocêncio de Sousa Gorayeb (Museu Paraense Emílio Goeldi, Belém, Brazil) verified the identification of the species. The collected specimens were deposited at the Entomology Museum of the Federal University of Fronteira Sul, Laranjeiras do Sul campus, Paraná, Brazil.
DNA extraction
The extraction of DNA from the mouthparts was initially carried out for the three most abundant species of tabanid. After these analyses, DNA was also extracted from the other species of Dichelacera captured, D. januarii.
The flies were washed twice with 70% ethanol solution and twice with sterile distilled water. The mouthparts were removed with the aid of sterile fine scissors under an entomological magnifying glass. The mouthparts were stored in 1.5-mL microtubes in Tris–NaCl–ethylenediaminetetraacetic acid (ETDA) buffer (10 mM Tris base, 200 mM NaCl and 50 mM EDTA), and stored frozen at -80 °C until DNA extraction.
For DNA extraction, the mouthparts were placed in a 1.5-mL microtube and macerated with an appropriate sized pistil. The DNA sample was extracted once with phenol (pH 7.8), once with phenol:chloroform (1:1), and once with chloroform:isoamyl alcohol (24:1). The DNA of the sample was then precipitated using sodium acetate (pH 6.0) and absolute ethanol and resuspended in 50 µL Tris–EDTA buffer (10 mM Tris–HCl, 1 mM EDTA) [24].
Polymerase chain reaction amplification
Flies were individually screened for the presence of Trypanosoma evansi and Trypanosoma vivax using specific oligonucleotide primers, RoTat 1.2 forward 5′GCGGGGTGTTTAAAGCAATA3′ and RoTat 1.2 reverse 5′ATTAGTGCTGCGTGTGTTCG3′ for T. evansi [24], and TviSL1 5′GCTCTCCAATCTTAACCCTA3′ and TviSL2 5′GTTCCAGGCGTGCAAACGTC3′ for T. vivax [25]. The first two primers amplified a 205-base pair (bp) fragment and the second two a 210-bp fragment. Polymerase chain reaction (PCR) was conducted in a 400-µL reaction mixture comprising 323.5 µL deionized water, 10.5 µL MgCl2, 1.75 µL Taq DNA polymerase, 7 µL deoxyribonucleotide triphosphate mix (10 mM), 35 µL of 10× Taq DNA polymerase buffer, 10.5 µL of each forward primer, 7 µL of each reverse primer, and 5 µL of the template. Trypanosoma evansi DNA was obtained from parasites purified from the blood of experimentally infected albino rats. Trypanosoma vivax DNA was obtained from purified parasites of experimentally infected sheep (approved by the Animal Experimentation Ethics Committee of Universidade do Estado de Santa Catarina) and was used as a positive control. Nuclease-free water was added to the PCR mix instead of a DNA sample as a negative control.
PCR was performed using an automated DNA thermal cycler (Biocycler). The amplification conditions were: initial denaturation at 94 °C for 3 min followed by 35 denaturation cycles at 94 °C for 30 s, annealing at 62 °C for 30 s, primer extension at 72 °C for 1 min, and a final extension at 72 °C for 4 min. The final phase of the PCR included cooling the samples to 10 °C. The PCR products were visualized on a 1% agarose gel stained with ethidium bromide.
Sequencing and Basic Local Alignment Search Tool
The PCR amplicons were purified using the QIAGEN Gel Purification Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol. Sequencing was conducted using the BigDye Terminator Cycle Sequencing Kit according to the manufacturer’s protocol (Applied Biosystems, Carlsbad, CA). The eluent was loaded into a 96-well plate which was placed into an ABI Prism 3500 Genetic Analyzer (Applied Biosystems).
Each DNA sample was purified according to the following protocol: 50 µL sample DNA was added to a mixture containing 5 µL of 3 M sodium acetate, 125 µL of 100% ethanol, and 2 µL glycogen (20 mg/ml) and placed in a freezer at − 80 °C for 1 h. Following centrifugation at 12,000 g for 45 min at 4 °C, the pellet formed was washed once with 75% ethanol and centrifuged for another 15 min at 75,000 g at 4 °C. The mixture was then dried in a SpeedVac at 20–25 °C for 30 min and resuspended in 20 µL ultrapure water (Milli-Q).
The retrieved gene sequences were edited using BioEdit software [26]. The nucleotide Basic Local Alignment Search Tool (BLASTn) was used (www.ncbi.nlm.nih.gov/blast/) to confirm the sequences obtained from the PCR analysis. Gene sequences with match scores of 80–100% similarity were considered significant.
