Skip to main content
Download PDF

Molecular survey on vector-borne pathogens in clinically healthy stray cats in Zaragoza (Spain)

Parasites & Vectors volume 16, Article number: 428 (2023) Cite this article

Abstract

Background

In Europe, feline vector-borne infections are gaining importance because of the changing climate, expanding habitats of potential vectors and expanding pathogen reservoirs. The main objective of this study was to assess the prevalence of vector-borne pathogens (VBPs) in stray cats in Zaragoza, Spain, and to investigate potential risk factors for infection, including feline leukaemia virus (FeLV) and feline immunodeficiency virus (FIV).

Methods

Blood samples from stray cats presented to the veterinary faculty in Zaragoza between February 2020 and 2022 were tested by polymerase chain reaction (PCR) for the presence of Anaplasma phagocytophilum, Anaplasma platys, Bartonella henselae, Ehrlichia canis, Rickettsia spp., haemotropic Mycoplasma spp., Hepatozoon spp., Leishmania infantum, piroplasms and microfilariae at the LABOKLIN laboratory. The cats were also tested for FeLV and FIV by PCR.

Results

Nearly half of the cats (158/332, 47.6%) were positive for at least one VBP. Hepatozoon spp. were detected in 25.6%, haemotropic Mycoplasma spp. in 22.9%, B. henselae in 9.3% and L. infantum in 2.1% of the cats. Male sex had a statistically significant association with test results for haemotropic Mycoplasma spp. (odds ratio 1.38 [1.21;1.57]); regionality with Hepatozoon spp., B. henseale and FIV; and seasonality with Hepatozoon spp., haemotropic Mycoplasma spp., L. infantum and FeLV (P ≤ 0.05 each). A strong positive correlation was reported for the amount of rainfall and the number of cats that tested positive for Hepatozoon spp. (ρ = 753, P = 0.05). None of the cats tested positive for A. phagocytophilum, A. platys, E. canis, Rickettsia spp., piroplasms, or microfilariae. Co-infections with multiple VBPs were detected in 56 out of 332 cats (16.9%). Thirty-one of the 332 cats included in the study (9.3%) tested positive for FeLV (6.9%) and for FIV (3.6%). In 20/31 cats (64.5%) that tested positive for FeLV/FIV, coinfections with VBP were detected (P = 0.048, OR 2.15 [0.99; 4.64]).

Conclusions

VBPs were frequently detected in stray cats in Zaragoza. In particular, regionality and seasonality had a statistically significant association with PCR results for most VBPs included in the study.

Graphical Abstract

Highlights

  • Nearly half of the cats tested positive for at least one vector-borne pathogen by PCR

  • Hepatozoon felis, haemotropic Mycoplasma, Bartonella and Leishmania were detected

  • Stray cats should be monitored to prevent and manage potential zoonotic diseases

Introduction

The importance of feline vector-borne pathogens (VBPs), transmitted by blood-feeding arthropods, is increasingly being recognized in Europe. Cats are exposed to arthropods, especially when living outdoors or as stray cats without ectoparasite prophylaxis and veterinary care [1,2,3]. Ectoparasites can transmit various parasitic, bacterial, or viral pathogens to animal hosts such as cats. Cats with immunosuppression as a result of feline leukaemia virus (FeLV) and feline immunodeficiency virus (FIV) infections are predisposed to vector-borne infections including leishmaniosis [4], hepatozoonosis [5,6,7] and cytauxzoonosis [8]. Screening for VBPs may be pivotal for animal and environmental risk assessment.

The distribution of feline VBPs is mainly dependent on the habitats of the transmitting vectors [2]. Consequently, Anaplasma phagocytophilum infections have most often been recognized in northern, central, or eastern Europe [9]. The occurrence of Leishmania infantum infections has been linked to habitats of phlebotomine sand flies in the Mediterranean and Southeastern Europe [9]. Infections with Hepatozoon felis and less frequently with H. canis and H. silvestris were detected in the Mediterranean and Southeastern Europe [10,11,12,13,14]. Feline infections with Dirofilaria immitis are mainly reported within the Mediterranean and Southeastern Europe [15, 16]. Finally, infections with Dirofilaria repens are rare in cats [17]. Other documented VBPs affecting cats in Europe include helminths (e.g. Thelazia callipaeda, Dipylidium caninum), bacteria (e.g. Borrelia burgdorferi sensu lato, Bartonella spp., Francisella tularensis), protozoa (e.g. Babesia spp., Theileria spp., Cytauxzoon sp.) and viruses (Flaviviridae) [2]. For many of these feline VBPs, infections in humans have been reported as well. This, for example, includes Bartonella henselae and B. clarridgeiae as the causative agents of cat scratch disease in humans [18], Leishmania infantum causing human leishmaniosis [19], A. phagocytophilum causing human granulocytic anaplasmosis [20], D. repens causing subcutaneous dirofilariosis [21] and D. immitis causing heartworm infections [21]. Haemotropic Mycoplasma spp. are bacteria that are classified within the Mycoplasma genus but cannot be cultivated [22]. Mycoplasma haemofelis, Candidatus Mycoplasma haemominutum and Candidatus Mycoplasma turicensis are the most commonly detected species in cats [23].

The aims of this study were to investigate the prevalence of several VBPs in stray cats in the city of Zaragoza, Spain, and to identify potential risk factors for infection.

Materials and methods

Study areas, cat population and sampling

The study was carried out in the city of Zaragoza (41°38′58.8948ʺN, 0°53′15.7632ʺW, the Aragon region of Spain). The study population included stray European shorthair cats captured in different areas of Zaragoza from February 2020 to October 2022 as part of a trap, neuter and release sterilization programme that ran locally to control stray populations. Captured stray cats were anaesthetized with a combination of dexmedetomidine (Dexdomitor®; 15 µg/kg, subcutaneous injection), ketamine (Anaestamine®; 5 mg/kg, subcutaneous injection) and methadone (Semfortan®; 0.3 mg/kg, subcutaneous injection). Data on the breed, sex, blood collection date and colony of origin (postal code) of each cat were recorded. A complete physical examination was carried out before sampling. Only cats older than 1 year and classified as apparently healthy based on the general examination were included. Prior to blood collection, the fur of the cats was trimmed around the jugular region. Sampling consisted of collecting 1 ml of blood aseptically by jugular venepuncture, with the collected volume placed in a tube containing ethylenediaminetetraacetic acid (EDTA) anticoagulant for PCR analysis. Blood was stored at − 20 °C until processing.

This survey was included under Project Licence PI75/20 approved by the Ethics Committee for Animal Experiments for the University of Zaragoza. The care and use of animals were performed according to the Spanish Policy for Animal Protection RD 53/2013, which meets the European Union Directive 2010/63 on the protection of animals used for experimental and other scientific purposes.

Molecular analysis

PCR testing of EDTA-blood was performed to detect A. phagocytophilum, A. platys, B. henselae, E. canis, Rickettsia spp., haemotropic Mycoplasma spp., Hepatozoon spp., L. infantum, piroplasms and microfilariae in the LABOKLIN laboratory (Bad Kissingen, Germany). Additionally, PCR testing was performed for FeLV and FIV. The molecular methods applied for investigation with descriptions of the gene targets at the LABOKLIN laboratory are summarized in Table 1. Furthermore, additional PCR protocols were used for sequence analysis of Bartonella spp. and Hepatozoon spp. (Table 1).

Table 1 Methodology of PCR testing applied for the detection of vector-borne pathogens performed in the present study
Full size table

Bartonella and Hepatozoon species identification and sequence analysis

For Bartonella sp. identification, samples that tested positive with Bartonella sp. qPCR were submitted to a conventional PCR (cPCR) assay amplifying an ~ 603 bp fragment of the 16S-23S intergenic transcribed spacer (ITS) region (Table 1) [24]. The cPCR cycling conditions consisted of an initial denaturation step at 94 °C for 2 min, followed by 40 cycles of 94 °C for 15 s, 60 °C for 15 s and 72 °C for 45 s. The ITS cPCR products were sequenced for further identification and characterization. Furthermore, the partial 16S rRNA fragment from all ITS cPCR positive samples was amplified for genotype characterization by using the type-specific primers Bh1_R (5′- CCGATAAATCTTTCTCCCTAA -3′) and Bh2_R (5′- CCGATAAATCTTTCTCCAAAT -3′) in combination with the broad-host-range primer 16SF [5′-AGAGTTTGATCCTGG(CT)TCAG-3′] as described previously (51) (Table 1). The cPCR cycling conditions consisted of an initial denaturation step at 94 °C for 2 min, followed by 40 cycles of 94 °C for 15 s, 57 °C for 15 s and 72 °C for 15 s. All cPCR assays were performed in a final volume of 25 µl that contained 2 µl of DNA extract, 2.5 µl of 10 × TaKaRa LA Taq buffer, 0.25 µl of TaKaRa LA Taq enzyme (Takara Bio Europe S.A.S.Saint-Germain-en-Laye, France), 2.5 µl of MgCl2 (25 mM), 1 µl each of forward and reverse primers (50 µM), 4 µl of dNTPs and PCR grade water up to 25 µl. For species and genotype characterization, the obtained ITS cPCR products were sequenced in both directions using BigDye 3.1 Ready Reaction Mix (Applied Biosystems) according to the manufacturer’s instructions.

For Hepatozoon species identification, a 779-bp fragment of the 18S rRNA gene was amplified using the primers Hep18S-F74 (5’- CAGTAAAACTGCAAATGGCTCAT-3’) and Hep18S-R853 (5’-CCAATAATGTAGAACCAAAATCCT-3’). The 25 µl PCR mixture contained the following: 15.25 µl PCR-grade water, 5 µl 5 × reaction buffer (Biozym, Oldendorf, Germany), 1 µl of each primer (10 pmol), 0.25 µl of Biozym HS Taq DNA Polymerase and 2.5 µl template DNA. The cPCR cycling conditions consisted of an initial denaturation step at 98 °C for 2 min followed by 40 cycles of 98 °C for 15 s, 55.5 °C for 15 s and 72 °C for 15 s. Hepatozoon 18S rRNA amplicons were Sanger sequenced by LGC Genomics, Berlin, Germany.

The genomic sequences obtained in this study were edited using Geneious 10.1.3 2020 version (Biomatters Ltd., Auckland, New Zealand) and submitted to a BLAST search (BLASTn; https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome) using default values to find homologous hits. For the phylogenetic analyses, sequences were aligned using the L-INS-I algorithm of the Geneious MAFFT plugin with default settings. A maximum likelihood (ML) phylogenetic tree with 1000 bootstrap resamplings using the GTR-GAMMA nucleotide model was performed using the Geneious RAxML plugin.

Statistical analysis

Statistical analysis was carried out using SPSS for Windows (version 28.0; IBM). P ≤ 0.05 was regarded as statistically significant. The dataset was tested for adherence to a normal distribution in cats that tested positive for VBPs by Shapiro-Wilk testing. For normally distributed data, the chi-square test and Fisher’s exact test were used to calculate statistical significance. For data on seasonality, which were not normally distributed, Kruskal-Wallis testing was used to calculate statistical significance. The different seasons were defined as follows: spring from 21 March to 20 June, summer from 21 June to 22 September, autumn from 23 September to 31 December and winter from 1 January to 20 March. Binomial logistic regression was performed to determine the effect of sex, regional distribution and seasonality on the PCR test results.

Spearman’s rank correlation coefficient (ρ) was calculated to correlate the percentage of cats testing positive for the individual VBPs with the amounts of rainfall and average temperatures in the individual months of the study (https://www.aemet.es/es/serviciosclimaticos/datosclimatologicos). ρ < 0.2 was classified as a very low correlation, ρ = 0.2–0.5 as a low correlation, ρ > 0.5–0.7 as a medium correlation, ρ > 0.7–0.9 as a strong correlation and ρ > 0.9 as a very strong correlation.

Results

Out of the 332 cats included in this study, 158 (47.6%) tested positive for at least one VBP (Table 2). Hepatozoon spp. (85 out of 332 cats, 25.6%), haemotropic Mycoplasma spp. (76 out of 332 cats, 22.9%), B. henselae (31 out of 332 cats, 9.3%) and L. infantum (7 out of 332 cats, 2.1%) were detected. None of the cats tested positive for A. phagocytophilum, A. platys, E. canis or Rickettsia spp. Twenty-three of 332 cats (6.9%) tested PCR positive for FeLV, and 12 of 332 cats (3.6%) tested PCR positive for FIV. In 21 of the 31 cats that tested positive for FeLV and/or FIV, coinfections with VBPs were detected (P = 0.048, OR = 2.15 [95% CI 0.99–4.64]).

Table 2 Proportions of the molecularly detected pathogens in stray cats from Zaragoza, Spain
Full size table

In 56/158 cats (35.4%) that tested positive, co-infections with more than one vector-borne pathogen were recognized. Most often, haemotropic Mycoplasma spp. (46 out of 56 cats, 82.1%) were involved, followed by Hepatozoon spp. (29 out of 56 cats, 51.8%), B. henselae (17 out of 56 cats, 30.4%) and L. infantum (5 out of 56 cats, 8.9%). In 43 out of 56 cats (76.8%), co-infections with two pathogens were recognized; in 12 cats (21.4%), co-infections with three pathogens; in one cat (1.8%), co-infections were with four pathogens.

Of 31 samples that yielded amplicons of the expected size when using cPCR targeting the 16S-23S ITS region of Bartonella spp., 28 (96.6%) were characterized as 16S B. henselae type II and one as B. henselae type I based on the 16S rRNA cPCR assay (Table 2). The identity of the two remaining samples (cats #48 and #122) could not be determined because of the low quantity of the available DNA. Of the ITS-positive samples, 11/29 (37.5%) were successfully sequenced. Ten of the sequences were identical, so only two sequences were deposited in GenBank® under accession numbers: OQ918678 and OQ918679. According to the sequence data, B. henselae was the only species present with two different ITS sequence types detected that matched with the partial ITS sequences of the reference strains Houston I (BAO16RB) (catalogue #284–OQ918679) and Marseille II (CP072904) (catalogue #196–OQ918678), as stated in Additional file 1: Fig. S1.

A partial fragment of the 18S rRNA gene from Hepatozoon species was successfully amplified from 70 samples that tested positive in TaqMan real-time PCR for Hepatozoon spp. Nineteen H. felis sequence variants (variants A–S, OR263276-OR263294) were detected that showed 99.1–100% identity with the 18S rRNA gene of a Spanish H. felis isolate (AY620232). In one cat (catalogue #98), an H. canis sequence (OR263295) that was 100% identical to another H. canis isolate from Spain (AY150067) was detected (Additional file 1: Fig. S2). Considering regional distribution, sequence variants were different between areas: Central (variants A, D, G, O, Q and S), North (variants A, E, M and Q), South (variants A, E, F, I, O, P and Q), East (variants A, H, Q, R and S) and West (variants A, J, K and S).

Of 332 cats, 179 (53.9%) were female, and 153 (46.1%) were male. A statistically significant impact of sex on the test results was detected only for haemotropic Mycoplasma spp. (21/179 female [11.7%] and 55/153 male cats [35.9%] tested positive, P < 0.001, OR = 1.38; in 21 of the 31 cats testing positive for FeLV and/or FIV, coinfections with VBPs were detected (P = 0.048, OR = 2.15 [95% CI 1.21 -1.57]). There was no statistically significant impact of sex on Hepatozoon spp. (47/179 female [26.3%] and 38/153 male cats [24.8%] tested positive, P = 0.802), L. infantum (2/179 female [1.1%] and 5/153 male cats [3.3%] tested positive, P = 0.255), B. henselae (16/179 female [8.9%] and 15/153 male cats [9.8%] tested positive, P = 0.851), FeLV (8/179 female [4.5%] and 15/153 male cats [9.8%] tested positive, P = 0.081) or FIV (3/179 female [1.7%] and 9/153 male cats [5.9%] tested positive, P = 0.073).

The postal code of the area in which the cats were caught in Zaragoza was known for 322/332 cats (97.0%). There were statistically significant differences between regions and PCR positivity for Hepatozoon spp. (χ2 = 17.396, df = 4, P = 0.002), B. henselae (χ2 = 14.544, df = 4, P = 0.006) and FIV (χ2 = 11.961, df = 4, P = 0.018), which could not be demonstrated in haemotropic Mycoplasma spp. (χ2 = 4.395, df = 4, P = 0.355), L. infantum (χ2 = 7.523, df = 4, P = 0.111) and FeLV (χ2 = 3.060, df = 4, P = 0.548) (Table 3).

Table 3 Regional distribution of positive molecular test results for selected vector-borne pathogens and FeLV/FIV in stray cats in Zaragoza, Spain, according to postal codes (n tested positive/N total [%])
Full size table

Positive test results were not normally distributed for seasonality in cats testing positive for VBPs, FeLV and/or FIV (P < 0.001 each). Significant differences between seasons and PCR test results were observed for Hepatozoon spp. (P < 0.001), haemotropic Mycoplasma spp. (P = 0.048), L. infantum (P = 0.007) and FeLV (P = 0.045) when using the Kruskal-Wallis test but not for B. henselae (P = 0.111) and FIV (P = 0.674) (Table 4). Statistically significant differences in PCR results were observed when autumn and winter were compared for Hepatozoon spp. (P = 0.030, r = 0.2), haemotropic Mycoplasma spp. (P = 0.049, r = 0.2), L. infantum (P = 0.019, r = 0.3) and FeLV (P = 0.036, r = 0.2). Additionally, this was observed for spring and winter in Hepatozoon spp. (P < 0.001, r = 0.4) and for summer and winter in L. infantum (P = 0.010, r = 0.3) with weak to moderate effect sizes.

Table 4 Seasonal distribution of positive molecular test results for selected vector-borne pathogens and FeLV/FIV in stray cats in Zaragoza, Spain (n tested positive/N total [%])
Full size table

In binominal logistic regression analysis including 322 cats, seasonality with spring/autumn compared to summer/winter (B = 0.823, Wald = 8.867, P = 0.003, OR = 2.28 [95% CI 1.33–3.92]) and regionality with southern parts of Zaragoza compared to all other areas (B = 1.195, Wald = 7.48, P = 0.006, OR = 3.30 [95% CI 1.40–7.78]) contributed significantly to positive test results for Hepatozoon spp. but not male sex compared to female sex (P = 0.945). The binomial logistic regression model was statistically significant (χ2(3) = 15.233, P = 0.002). Goodness of fit was assessed using the Hosmer-Lemeshow test, indicating a good model fit (χ2(3) = 0.731, P > 0.05). Correlations between predictor variables were low (r < 0.70), indicating that multicollinearity was not a confounding factor in the analysis.

For haemotropic Mycoplasma spp., the binomial logistic regression model was statistically significant (χ2(3) = 30.557, P < 0.001). Goodness of fit was assessed using the Hosmer-Lemeshow test, indicating a good model fit (χ2(3) = 1.200, P > 0.05). Correlations between predictor variables were low (r < 0.70), indicating that multicollinearity was not a confounding factor in the analysis. Male sex had a statistically significant impact on the PCR results (B = 1.477, Wald = 23.747, P < 0.001, OR = 4.38 [95% CI 2.42–7.94]). Regionality with southern parts compared to all others (P = 0.104) and seasonality with winter compared to all other seasons (P = 0.246) did not show statistical significance.

For B. henseale, the binomial logistic regression model did not show any statistically significant impact of regionality (southern areas compared to all others, P = 0.989), seasonality (winter compared to all other seasons, P = 0.146) or male sex (P = 0.624) on the results of PCR-testing.

A strong positive correlation was reported for the amounts of rainfall and the percentages of cats testing positive for Hepatozoon spp. (ρ = 753, P = 0.05, Table 5). For haemotropic Mycoplasma spp. and L. infantum, no statistically significant correlations were detected with the amounts of rainfall (Additional file 1: Fig. S3) and the average temperature (Additional file 1: Fig. S4) in the individual months of the study (P > 0.05 each) (Table 5).

Table 5 Correlation between percentages of cats tested positive for haemotropic Mycoplasma spp., Hepatozoon spp. and Leishmania infantum in the individual months of the study with amounts of rainfall (mm) and temperature (°C) using Spearman’s rank correlation coefficient
Full size table

Discussion

Almost half of the cats in our study (47.6%) tested positive for at least one VBP by molecular analysis. This is highly indicative of infection, in contrast to positive serological antibody detection demonstrating pathogen contact in the past. This study shows that clinicians should consider vector-borne diseases as potential differential diagnoses in cats that originate from or have travelled to endemic regions. In general, the occurrence of VBPs is associated with the distribution of their vectors, which are influenced by factors such as climate, land use and human density. Spain has a highly variable climate, ranging from a continental humid climate to a Mediterranean climate. In Zaragoza, the climate is Mediterranean, with a marked continental influence, characterized by low rainfall (320 mm per year) and moderate average temperatures (15.3 °C). However, the confluence in the study area of several rivers may favour the existence of differentiated environments. This particularity could explain the results obtained in the central area (Table 3), with a higher number of animals testing positive for the pathogens evaluated in this study.

Seasonal distribution was also been analysed in the present study. We detected seasonal differences mainly in Hepatozoon spp., haemotropic Mycoplasma spp. and L. infantum. For Hepatozoon spp., more positive samples were detected in spring, followed by autumn and finally summer. Although little is known about the epidemiology of Hepatozoon in cats, arthropod activity in these seasons in Spain could pose a risk to free-roaming cats. For haemotropic Mycoplasma spp., a higher number of positive animals were detected in the winter and a possible justification could be that during this season the animals are more likely to live in groups, favouring the transmission of these pathogens. Finally, L. infantum has been detected more frequently in animals in winter, which might be explained by the variable and long incubation time after sandfly infection during the warmer seasons.

We observed differences between the regional distributions of selected VBPs in Zaragoza (Table 3). The comparison of results between this study and other studies published in Spain and other European Mediterranean countries is difficult and not always possible. The highly statistically significant impact of rainfall on Hepatozoon spp. with a strong positive correlation (P = 0.005, P = 0.753) is remarkable. To the authors’ knowledge, this type of association has never published before.

Co-infections were recognized in 35.4% (56/158) of the cats that tested positive. One cat (1.8%) had a quadruple infection, 12 cats (21.4%) had a triple infection, and 43 cats (76.8%) had a double infection. Co-infections with multiple VBPs can complicate diagnosis and treatment in dogs. A higher percentage of co-infections with other VBPs may lead to more marked laboratory abnormalities and severity in the case of canine leishmaniosis [25]. However, limited information is available in cats, although it is plausible that co-infections could predispose cats to immune system exhaustion.

Hepatozoon sp. DNA was detected in 25.6% (85/332) of the stray cats in this study. The diagnosis of Hepatozoon spp. in cats from Zaragoza reported herein supports that this protozoan is widespread on the Iberian Peninsula, considering the descriptions recently reported in cat populations from Portugal and different regions of Spain [7, 26,27,28,29]. The Hepatozoon infection prevalence described in previous Spanish studies varied from 0.6% [28] to 4% in cats from the Barcelona area [29] and was as high as 16% in a cat colony from Barcelona [7], in all cases lower than the prevalence reported in our study. These differences in the number of cats that tested positive could be due to the vector distribution, characteristics of the cat populations and differences in the molecular detection methods used. In the present study, the stray status of cats and possible major exposure to ectoparasites may explain the higher prevalence detected. Hepatozoon spp. are transmitted by ingestion of the final host containing mature oocysts by the intermediate host [30]. Although the vectors of feline hepatozoonosis are still unknown, it is expected that H. felis is transmitted by a haematophagous arthropod, as demonstrated for other Hepatozoon spp. transmitted by fleas, ticks, mites, lice, mosquitoes and sand flies [11]. Variations in the possible vector distribution can explain, at least partially, the differences in Hepatozoon sp. infection rates described in studies performed in different regions. Other transmission modes have been described for some Hepatozoon spp., including intrauterine transmission and carnivorism [12, 31,32,33].

Hepatozoon canis was detected in one of the cats (catalogue #98). Although H. canis is usually found in dogs and wild carnivores, it was previously also detected in cats from other countries, including France, Italy and Israel [12, 13, 34].

In the present study, a high haemotropic Mycoplasma sp. infection percentage (107/332, 32.2%) was recorded, with Candidatus M. haemominutum most frequently detected (61/332, 18.4%), followed by M. haemofelis (35/332, 10.5%) and Candidatus M. turicensis (11/332, 3.1%). These data are quite similar to those from previous studies in Spain. In the Barcelona region, the previously reported haemotropic Mycoplasma sp. prevalence ranged from 7.8% to 11.9% [35, 36], and it was 10.6% in Madrid [37]. In Italy, similar prevalence estimates (11.6% to 18.3%) were reported [1, 3, 38, 39]. However, higher haemotropic Mycoplasma spp. prevalence has been reported in Cyprus (26.4%) [40] and Portugal (27.1%) [41]. Haemotropic Mycoplasma sp. are frequent in European cats, with slight differences within the countries. A higher risk of testing positive for haemotropic Mycoplasma spp. in male cats than in female cats was also demonstrated in a study of cats in Bangkok, Thailand [42], which is consistent with our results.

The occurrence of Bartonella sp. in cats from different areas of Spain is reported with frequencies ranging from 0.3 to 38.3% [29, 35, 43,44,45]. The detection of Bartonella sp. infection (9.3%) in stray cats from Zaragoza reported herein confirms that these bacteria are widespread in Spain, similar to previous observations in cats from other areas (11.9% in Barcelona) of the country [36]. Furthermore, our results are in line with those of previous studies investigating free-roaming cats in Germany (16.3%) [46] and Italy (18%) [47]. In contrast, the Bartonella sp. prevalence estimate reported herein is higher than that recorded in studies investigating pet cats with indoor lifestyles in the USA (< 5.0%) [48] or Egypt (3.0%) [49], highlighting the different risk of cats being exposed to risk factors (e.g. ectoparasite infestation) based on their lifestyle.

Based on the heterogeneity of the ITS and 16SrRNA region sequences, the species B. henselae includes genotype I (Houston I) and genotype II (Marseille) and different subtypes [24, 50]. The two genotypes display geographical heterogeneity, wherein genotype II is prevalent in European countries and the USA [1, 3, 46, 51], while genotype I is mainly reported in Asia and North Africa [49, 52, 53]. In the present study, B. henselae was the unique species detected, with 16S rRNA/ITS type II (8.4%) being found more frequently than type I (0.3%), in line with what has already been documented in Western countries.

The cat is the main animal host reservoir of Bartonella henselae, B. clarridgeiae and B. koehlerae [18, 54]. Bartonella clarridgeiae and B. koehlerae were not detected in stray cats from the Zaragoza region in the present study, although their presence cannot be confidently excluded in the area, as two of the samples that tested positive by generic qPCR could not be re-amplified by conventional PCR because of the low DNA quantity available, so the identity of these two samples could not be determined.

Of interest, Bartonella sp. and haemotropic Mycoplasma spp. co-infection (7/332, 2.1%) was observed herein, similar to in previous studies conducted in the Barcelona region (4.4%) [36] and in Italy (0.1% to 3%) [1, 38, 39].

In the present study, the Leishmania sp. infection percentage was 2.1% (7/332). In Spain, PCR positive percentages of 5.6% and 6% were recorded in blood samples from cats in Zaragoza [55] and Murcia [56], respectively. A study performed by Ortuno et al. (2023) revealed a higher detection percentage of the pathogen by PCR in the skin and lymphoid tissue than in the blood of cats and in the skin of healthy cats than in the skin of cats with clinical signs [56]. Another study suggested that PCR testing of conjunctival swabs is more sensitive test than that of peripheral blood [57]; however, this is highly dependent on the cellularity of the swabs. The relatively low infection percentage observed in the present study may thus in part be explained by the type of sample used, as demonstrated for canine leishmaniosis as well [58], and the fact that only clinically healthy stray cats were included in the study.

Anaplasma phagocytophilum, A. platys and E. canis DNA was not detected in this study. The prevalence of these two tick-transmitted genera described in previous Spanish studies varied from 0 to 1% [36]. In contrast, a high molecular prevalence of E. canis (9.9%) and A. phagocytophilum (8.4%) was described in cats from Madrid, Spain [43]. Anaplasma and Ehrlichia infections in cats are generally rare in southern European countries [36, 38, 59], which is in accordance with the results of the present study. For A. phagocytophilum, this is probably due to the distribution of ticks of the Ixodes persulcatus complex as competent vectors, which are only rarely detected in Mediterranean countries and more frequently found in Central or Northern Europe [60].

Rickettsia spp., Piroplasmida (Babesia spp., Theileria spp., Cytauxzoon sp.) and microfilariae (D. immitis, D. repens, Acanthocheilonema reconditum) DNA was not detected in the present study. Feline piroplasmid infection is quite common in Europe. Piroplasmid infection is caused by Cytauxzoon sp., with a prevalence in Spain of 1.2% [8]. In Italy, a few reports of Cytauxzoon sp. infection have been published from the northern and central regions [61, 62]. Other piroplasms usually associated with dogs, such as Babesia vogeli [63] and Babesia canis [27], have also been described in European cats.

Microfilariae infections in cats appear to be rare and have only been sporadically documented in cats from Mediterranean regions, although a seropositivity of 24.4% was recently reported in stray cats from Zaragoza [64], and infections of two cats by D. immitis and D. repens were recently reported in Italy [65]. However, limitations in cats associated with PCR testing should be considered, as cats most often do not show prominent numbers of microfilariae in the peripheral blood, resulting in false-negative PCR results [66].

Limitations of this study

The limitations of this study are mainly its retrospective design, predominantly due to missing anamnesis and information regarding clinical signs consistent with vector-borne infections. Probably, no ectoparasite prophylaxis was applied in the cats included in the study, but this could not be ruled out with certainty. We were not able to include the haematological and biochemistry results of the tested cats.

Conclusions

Almost half of the cats (47.6%) tested positive for at least one vector-borne pathogen. The cats in the present study were apparently healthy, underlining the need for epidemiological studies of stray cats in Europe to identify zoonotic and non-zoonotic pathogens and the relevance of screening domestic cats for VBPs, especially in endemic areas. Immunosuppression (FeLV-/FIV infections) and male sex may contribute to positive results in molecular tests for vector-borne infectious agents.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Abbreviations

DNA:

Deoxyribonucleic acid

EDTA:

Ethylenediaminetetraacetic acid

FeLV:

Feline leukaemia virus

FIV:

Feline immunodeficiency virus

OR:

Odds ratio

PCR:

Polymerase chain reaction

rRNA:

Ribosomal ribonucleic acid

VBP:

Vector-borne pathogen

References

  1. Otranto D, Napoli E, Latrofa MS, Annoscia G, Tarallo VD, Greco G, et al. Feline and canine leishmaniosis and other vector-borne diseases in the Aeolian Islands: Pathogen and vector circulation in a confined environment. Vet Parasitol. 2017;236:144–51.

    Article  PubMed  Google Scholar 

  2. ESCCAP. Control of Vector-Borne Diseases in Dogs and Cats. European Scientific Counsel Companion Animal Parasites; 2019.

  3. Greco G, Brianti E, Buonavoglia C, Carelli G, Pollmeier M, Schunack B, et al. Effectiveness of a 10% imidacloprid/4.5% flumethrin polymer matrix collar in reducing the risk of Bartonella spp. infection in privately owned cats. Parasit Vectors. 2019;12:69.

    Article  PubMed  PubMed Central  Google Scholar 

  4. Pennisi MG, Persichetti MF. Feline leishmaniosis: is the cat a small dog? Vet Parasitol. 2018;251:131–7.

    Article  PubMed  PubMed Central  Google Scholar 

  5. Baneth G, Aroch I, Tal N, Harrus S. Hepatozoon species infection in domestic cats: a retrospective study. Vet Parasitol. 1998;79:123–33.

    Article  CAS  PubMed  Google Scholar 

  6. Beaufils JP, Martin-Granel J, Jumelle P. Hepatozoon spp. parasitemia and feline leukemia virus infection in two cats. Feline Practice. 1998;26:10–3.

    Google Scholar 

  7. Ortuno A, Castella J, Criado-Fornelio A, Buling A, Barba-Carretero JC. Molecular detection of a Hepatozoon species in stray cats from a feline colony in North-eastern Spain. Vet J. 2008;177:134–5.

    Article  CAS  PubMed  Google Scholar 

  8. Diaz-Reganon D, Villaescusa A, Ayllon T, Rodriguez-Franco F, Baneth G, Calleja-Bueno L, et al. Molecular detection of Hepatozoon spp. and Cytauxzoon sp. in domestic and stray cats from Madrid, Spain. Parasit Vectors. 2017;10:112.

    Article  PubMed  PubMed Central  Google Scholar 

  9. Iatta R, Furlanello T, Colella V, Tarallo VD, Latrofa MS, Brianti E, et al. A nationwide survey of Leishmania infantum infection in cats and associated risk factors in Italy. PLoS Negl Trop Dis. 2019;13:e0007594.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Baneth G. Perspectives on canine and feline hepatozoonosis. Vet Parasitol. 2011;181:3–11.

    Article  PubMed  Google Scholar 

  11. Smith TG. The genus Hepatozoon (Apicomplexa: Adeleina). J Parasitol. 1996;82:565–85.

    Article  CAS  PubMed  Google Scholar 

  12. Baneth G, Sheiner A, Eyal O, Hahn S, Beaufils JP, Anug Y, et al. Redescription of Hepatozoon felis (Apicomplexa: Hepatozoidae) based on phylogenetic analysis, tissue and blood form morphology, and possible transplacental transmission. Parasit Vectors. 2013. https://doi.org/10.1186/1756-3305-6-102.

    Article  PubMed  PubMed Central  Google Scholar 

  13. Giannelli A, Latrofa MS, Nachum-Biala Y, Hodzic A, Greco G, Attanasi A, et al. Three different Hepatozoon species in domestic cats from southern Italy. Ticks Tick Borne Dis. 2017;8:721–4.

    Article  PubMed  Google Scholar 

  14. Kegler K, Nufer U, Alic A, Posthaus H, Olias P, Basso W. Fatal infection with emerging apicomplexan parasite Hepatozoon silvestris in a domestic cat. Parasit Vectors. 2018;11:428.

    Article  PubMed  PubMed Central  Google Scholar 

  15. Traversa D, Aste G, Milillo P, Capelli G, Pampurini F, Tunesi C, et al. Autochthonous foci of canine and feline infections by Dirofilaria immitis and Dirofilaria repens in central Italy. Vet Parasitol. 2010;169:128–32.

    Article  PubMed  Google Scholar 

  16. Di Cesare A, Castagna G, Meloni S, Milillo P, Latrofa S, Otranto D, et al. Canine and feline infections by cardiopulmonary nematodes in central and southern Italy. Parasitol Res. 2011;109:S87-96.

    Article  PubMed  Google Scholar 

  17. Trotz-Williams LA, Trees AJ. Systematic review of the distribution of the major vector-borne parasitic infections in dogs and cats in Europe. Vet Rec. 2003;152:97–105.

    Article  CAS  PubMed  Google Scholar 

  18. Breitschwerdt EB, Kordick DL. Bartonella infection in animals: carriership, reservoir potential, pathogenicity, and zoonotic potential for human infection. Clin Microbiol Rev. 2000;13:428–38.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Burza S, Croft SL, Boelaert M. Leishmaniasis. Lancet. 2018;392:951–70.

    Article  PubMed  Google Scholar 

  20. MacQueen D, Centellas F. Human granulocytic anaplasmosis. Infect Dis Clin North Am. 2022;36:639–54.

    Article  PubMed  Google Scholar 

  21. Simon F, Diosdado A, Siles-Lucas M, Kartashev V, Gonzalez-Miguel J. Human dirofilariosis in the 21st century: a scoping review of clinical cases reported in the literature. Transbound Emerg Dis. 2021.

  22. Neimark H, Johansson KE, Rikihisa Y, Tully JG. Proposal to transfer some members of the genera Haemobartonella and Eperythrozoon to the genus Mycoplasma with descriptions of 'Candidatus Mycoplasma haemofelis’, 'Candidatus Mycoplasma haemomuris’, 'Candidatus Mycoplasma haemosuis’ and 'Candidatus Mycoplasma wenyonii’. Int J Syst Evol Microbiol. 2001;51:891–9.

    Article  CAS  PubMed  Google Scholar 

  23. Messick JB. Hemotrophic mycoplasmas (hemoplasmas): a review and new insights into pathogenic potential. Vet Clin Pathol. 2004;33:2–13.

    Article  PubMed  Google Scholar 

  24. Diniz PP, Maggi RG, Schwartz DS, Cadenas MB, Bradley JM, Hegarty B, et al. Canine bartonellosis: serological and molecular prevalence in Brazil and evidence of co-infection with Bartonella henselae and Bartonella vinsonii subsp. berkhoffii. Vet Res. 2007;38:697–710.

    Article  CAS  PubMed  Google Scholar 

  25. Baxarias M, Alvarez-Fernandez A, Martinez-Orellana P, Montserrat-Sangra S, Ordeix L, Rojas A, et al. Does co-infection with vector-borne pathogens play a role in clinical canine leishmaniosis? Parasit Vectors. 2018;11:135.

    Article  PubMed  PubMed Central  Google Scholar 

  26. Maia C, Ramos C, Coimbra M, Bastos F, Martins A, Pinto P, et al. Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal. Parasit Vectors. 2014;7:115.

    Article  PubMed  PubMed Central  Google Scholar 

  27. Vilhena H, Martinez-Diaz VL, Cardoso L, Vieira L, Altet L, Francino O, et al. Feline vector-borne pathogens in the north and centre of Portugal. Parasit Vectors. 2013;6:99.

    Article  PubMed  PubMed Central  Google Scholar 

  28. Criado-Fornelio A, Ruas JL, Casado N, Farias NA, Soares MP, Muller G, et al. New molecular data on mammalian Hepatozoon species (Apicomplexa: Adeleorina) from Brazil and Spain. J Parasitol. 2006;92:93–9.

    Article  CAS  PubMed  Google Scholar 

  29. Tabar MD, Altet L, Francino O, Sanchez A, Ferrer L, Roura X. Vector-borne infections in cats: molecular study in Barcelona area (Spain). Vet Parasitol. 2008;151:332–6.

    Article  CAS  PubMed  Google Scholar 

  30. Baneth G, Mathew JS, Shkap V, Macintire DK, Barta JR, Ewing SA. Canine hepatozoonosis: two disease syndromes caused by separate Hepatozoon spp. Trends Parasitol. 2003;19:27–31.

    Article  PubMed  Google Scholar 

  31. Murata T, Inoue M, Tateyama S, Taura Y, Nakama S. Vertical transmission of Hepatozoon canis in dogs. J Vet Med Sci. 1993;55:867–8.

    Article  CAS  PubMed  Google Scholar 

  32. Schäfer I, Müller E, Nijhof AM, Aupperle-Lellbach H, Loesenbeck G, Cramer S, et al. First evidence of vertical Hepatozoon canis transmission in dogs in Europe. Parasit Vectors. 2022;15:296.

    Article  PubMed  PubMed Central  Google Scholar 

  33. Johnson EM, Panciera RJ, Allen KE, Sheets ME, Beal JD, Ewing SA, et al. Alternate pathway of infection with Hepatozoon americanum and the epidemiologic importance of predation. J Vet Intern Med. 2009;23:1315–8.

    Article  CAS  PubMed  Google Scholar 

  34. Criado-Fornelio A, Buling A, Pingret JL, Etievant M, Boucraut-Baralon C, Alongi A, et al. Hemoprotozoa of domestic animals in France: prevalence and molecular characterization. Vet Parasitol. 2009;159:73–6.

    Article  CAS  PubMed  Google Scholar 

  35. Ravicini S, Pastor J, Hawley J, Brewer M, Castro-Lopez J, Beall M, et al. Prevalence of selected infectious disease agents in stray cats in Catalonia, Spain. JFMS Open Rep. 2016;2:2055116916634109.

    PubMed  PubMed Central  Google Scholar 

  36. Alvarez-Fernandez A, Maggi R, Martin-Valls GE, Baxarias M, Breitschwerdt EB, Solano-Gallego L. Prospective serological and molecular cross-sectional study focusing on Bartonella and other blood-borne organisms in cats from Catalonia (Spain). Parasit Vectors. 2022;15:6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Diaz-Reganon D, Villaescusa A, Ayllon T, Rodriguez-Franco F, Garcia-Sancho M, Agulla B, et al. Epidemiological study of hemotropic mycoplasmas (hemoplasmas) in cats from central Spain. Parasit Vectors. 2018;11:140.

    Article  PubMed  PubMed Central  Google Scholar 

  38. Latrofa MS, Iatta R, Toniolo F, Furlanello T, Ravagnan S, Capelli G, et al. A molecular survey of vector-borne pathogens and haemoplasmas in owned cats across Italy. Parasit Vectors. 2020;13:116.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Persichetti MF, Pennisi MG, Vullo A, Masucci M, Migliazzo A, Solano-Gallego L. Clinical evaluation of outdoor cats exposed to ectoparasites and associated risk for vector-borne infections in southern Italy. Parasit Vectors. 2018;11:136.

    Article  PubMed  PubMed Central  Google Scholar 

  40. Attipa C, Papasouliotis K, Solano-Gallego L, Baneth G, Nachum-Biala Y, Sarvani E, et al. Prevalence study and risk factor analysis of selected bacterial, protozoal and viral, including vector-borne, pathogens in cats from Cyprus. Parasit Vectors. 2017;10:130.

    Article  PubMed  PubMed Central  Google Scholar 

  41. Duarte A, Marques V, Correia JH, Neto I, Braz BS, Rodrigues C, et al. Molecular detection of haemotropic Mycoplasma species in urban and rural cats from Portugal. J Feline Med Surg. 2015;17:516–22.

    Article  PubMed  Google Scholar 

  42. Do T, Kamyingkird K, Chimnoi W, Inpankaew T. Evaluation of hematological alteration of vector-borne pathogens in cats from Bangkok, Thailand. BMC Vet Res. 2021;17:28.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Ayllon T, Diniz PP, Breitschwerdt EB, Villaescusa A, Rodriguez-Franco F, Sainz A. Vector-borne diseases in client-owned and stray cats from Madrid, Spain. Vector Borne Zoonotic Dis. 2012;12:143–50.

    Article  PubMed  Google Scholar 

  44. Pons I, Sanfeliu I, Quesada M, Anton E, Sampere M, Font B, et al. Prevalence of Bartonella henselae in cats in Catalonia. Spain Am J Trop Med Hyg. 2005;72:453–7.

    Article  PubMed  Google Scholar 

  45. Alamán Valtierra M, Simón Valencia C, Fuertes Negro H, Unzueta Galarza A, Flores Somarriba B, Halaihel KN. Molecular epidemiology of Bartonella henselae in stray and sheltered cats of Zaragoza. Spain Rev Esp Salud Publica. 2016;90:E5.

    PubMed  Google Scholar 

  46. Arvand M, Klose AJ, Schwartz-Porsche D, Hahn H, Wendt C. Genetic variability and prevalence of Bartonella henselae in cats in Berlin, Germany, and analysis of its genetic relatedness to a strain from Berlin that is pathogenic for humans. J Clin Microbiol. 2001;39:743–6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  47. Fabbi M, De Giuli L, Tranquillo M, Bragoni R, Casiraghi M, Genchi C. Prevalence of Bartonella henselae in Italian stray cats: evaluation of serology to assess the risk of transmission of Bartonella to humans. J Clin Microbiol. 2004;42:264–8.

    Article  PubMed  PubMed Central  Google Scholar 

  48. Chomel BB, Abbott RC, Kasten RW, Floyd-Hawkins KA, Kass PH, Glaser CA, et al. Bartonella henselae prevalence in domestic cats in California: risk factors and association between bacteremia and antibody titers. J Clin Microbiol. 1995;33:2445–50.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  49. Zarea AAK, Tempesta M, Fouad EA, Ndiana LA, Mahmoud MS, Mrenoshki D, et al. Prevalence of Bartonella spp., haemotropic Mycoplasma spp. and others vector-borne pathogens in private-owned dogs and cats Egypt. Acta Trop. 2023;240:106857.

    Article  CAS  PubMed  Google Scholar 

  50. Bergmans AM, Schellekens JF, van Embden JD, Schouls LM. Predominance of two Bartonella henselae variants among cat-scratch disease patients in the Netherlands. J Clin Microbiol. 1996;34:254–60.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  51. Chomel BB, Boulouis HJ, Petersen H, Kasten RW, Yamamoto K, Chang CC, et al. Prevalence of Bartonella infection in domestic cats in Denmark. Vet Res. 2002;33:205–13.

    Article  PubMed  Google Scholar 

  52. Zarea AAK, Bezerra-Santos MA, Nguyen VL, Colella V, Dantas-Torres F, Halos L, et al. Occurrence and bacterial loads of Bartonella and haemotropic Mycoplasma species in privately owned cats and dogs and their fleas from East and Southeast Asia. Zoonoses Public Health. 2022;69:704–20.

    Article  PubMed  PubMed Central  Google Scholar 

  53. Chomel BB, Carlos ET, Kasten RW, Yamamoto K, Chang CC, Carlos RS, et al. Bartonella henselae and Bartonella clarridgeiae infection in domestic cats from The Philippines. Am J Trop Med Hyg. 1999;60:593–7.

    Article  CAS  PubMed  Google Scholar 

  54. Chomel BB, Kasten RW, Floyd-Hawkins K, Chi B, Yamamoto K, Roberts-Wilson J, et al. Experimental transmission of Bartonella henselae by the cat flea. J Clin Microbiol. 1996;34:1952–6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  55. Alcover MM, Basurco A, Fernandez A, Riera C, Fisa R, Gonzalez A, et al. A cross-sectional study of Leishmania infantum infection in stray cats in the city of Zaragoza (Spain) using serology and PCR. Parasit Vectors. 2021;14:178.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  56. Ortuno M, Bernal A, Nachum-Biala Y, Munoz C, Risueno J, Ortiz J, et al. Clinical, diagnostic and epidemiological implications of Hepatozoon spp., Babesia spp. and Leishmania infantum infection in cats and dogs in a Mediterranean periurban setting. Parasitol Res. 2023;122:35–47.

    Article  PubMed  Google Scholar 

  57. Morganti G, Veronesi F, Stefanetti V, Di Muccio T, Fiorentino E, Diaferia M, et al. Emerging feline vector-borne pathogens in Italy. Parasit Vectors. 2019;12:193.

    Article  PubMed  PubMed Central  Google Scholar 

  58. Solano-Gallego L, Miro G, Koutinas A, Cardoso L, Pennisi MG, Ferrer L, et al. LeishVet guidelines for the practical management of canine leishmaniosis. Parasit Vectors. 2011;4:86.

    Article  PubMed  PubMed Central  Google Scholar 

  59. Schäfer I, Kohn B. Anaplasma phagocytophilum infection in cats: a literature review to raise clinical awareness. J Feline Med Surg. 2020;22:428–41.

    Article  PubMed  PubMed Central  Google Scholar 

  60. Kahl O, Gray JS. The biology of Ixodes ricinus with emphasis on its ecology. Ticks Tick Borne Dis. 2023;14:102114.

    Article  PubMed  Google Scholar 

  61. Carli E, Trotta M, Chinelli R, Drigo M, Sinigoi L, Tosolini P, et al. Cytauxzoon sp. infection in the first endemic focus described in domestic cats in Europe. Vet Parasitol. 2012;183:343–52.

    Article  CAS  PubMed  Google Scholar 

  62. Carli E, Trotta M, Bianchi E, Furlanello T, Caldin M, Pietrobelli M, et al. Cytauxzoon sp. infection in two free ranging young cats: clinicopathological findings, therapy and follow up. Turkiye Parazitol Derg. 2014;38:185–9.

    Article  PubMed  Google Scholar 

  63. Maia C, Ferreira A, Nunes M, Vieira ML, Campino L, Cardoso L. Molecular detection of bacterial and parasitic pathogens in hard ticks from Portugal. Ticks Tick Borne Dis. 2014;5:409–14.

    Article  PubMed  Google Scholar 

  64. Villanueva-Saz S, Giner J, Verde M, Yzuel A, Gonzalez A, Lacasta D, et al. Prevalence of microfilariae, antigen and antibodies of feline dirofilariosis infection (Dirofilaria immitis) in the Zaragoza metropolitan area. Spain Vet Parasitol. 2021;23:100541.

    Google Scholar 

  65. Panarese R, Iatta R, Lia RP, Passantino G, Ciccarelli S, Gernone F, et al. Dirofilarioses in two cats in southern Italy. Parasitol Res. 2021;120:4247–51.

    Article  PubMed  Google Scholar 

  66. Pennisi MG, Tasker S, Hartmann K, Belak S, Addie D, Boucraut-Baralon C, et al. Dirofilarioses in cats: European guidelines from the ABCD on prevention and management. J Feline Med Surg. 2020;22:442–51.

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

We thank the staff of the Veterinary Teaching Hospital of the University of Zaragoza. We also thank Cátedra para el fomento de la protección y el bienestar animal, University of Zaragoza, Spain.

Funding

This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.

Author information

Authors and Affiliations

  1. Immunology Laboratory, Zaragoza Veterinary Faculty, Zaragoza University, Miguel Servet 177, 50013, Zaragoza, Spain

    Sergio Villanueva-Saz, Marivi Martínez, Antonio Fernández, Maite Verde, Delia Lacasta, Diana Marteles & Michele Trotta

  2. Animal Pathology Department, Zaragoza Veterinary Faculty, Zaragoza University, Miguel Servet 177, 50013, Zaragoza, Spain

    Sergio Villanueva-Saz, Marivi Martínez, Antonio Fernández, Maite Verde, Delia Lacasta & Diana Marteles

  3. Instituto Agroalimentario de Aragón‑IA2 (Universidad de Saragossa‑CITA), Zaragoza University, Miguel Servet 177, 50013, Zaragoza, Spain

    Sergio Villanueva-Saz, Maite Verde, Delia Lacasta & Diana Marteles

  4. Institute for Parasitology and Tropical Veterinary Medicine, Freie Universität Berlin, Robert-Von-Ostertag-Straße 7, 14163, Berlin, Germany

    Ard M. Nijhof & Bastian Gerst

  5. Veterinary Centre for Resistance Research, Freie Universität Berlin, 14163, Berlin, Germany

    Ard M. Nijhof & Bastian Gerst

  6. LABOKLIN GmbH and Co. KG, Steubenstraße 4, 97688, Bad Kissingen, Germany

    Michaela Gentil, Elisabeth Müller & Ingo Schäfer

  7. Hospital Veterinario Universidad de Zaragoza, Zaragoza University, Miguel Servet 177, 50013, Zaragoza, Spain

    Ana González

  8. Department of Veterinary Medicine, University of Bari “Aldo Moro”, 70010, Valenzano, Metropolitan City of Bari, Italy

    Mohamed Sh. Mohamud Yusuf & Grazia Greco

  9. Department of Animal Health, Experimental Zooprophylatic Institute of Southern Italy, Portici, 80055, Naples, Italy

    Giovanni Sgroi

Authors
  1. Sergio Villanueva-Saz
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Marivi Martínez
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Ard M. Nijhof
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Bastian Gerst
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Michaela Gentil
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Elisabeth Müller
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Antonio Fernández
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Ana González
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Mohamed Sh. Mohamud Yusuf
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Grazia Greco
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Maite Verde
    View author publications

    You can also search for this author in PubMed Google Scholar

  12. Giovanni Sgroi
    View author publications

    You can also search for this author in PubMed Google Scholar

  13. Delia Lacasta
    View author publications

    You can also search for this author in PubMed Google Scholar

  14. Diana Marteles
    View author publications

    You can also search for this author in PubMed Google Scholar

  15. Michele Trotta
    View author publications

    You can also search for this author in PubMed Google Scholar

  16. Ingo Schäfer
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

SVS and MM conceived and designed the experiments and initiated the study; AF, AG, MV performed the sample collection; DL collected the data. IS evaluated the data; IS, MM, GG and MT wrote the manuscript. EM and DM edited and reviewed the manuscript. MG did the PCR-testing for vector-borne infectious agents at LABOKLIN and edited the manuscript. BG and AMN performed the sequencing in cats tested positive for Hepatozoon spp. and edited the manuscript. GG and M.Y. performed the analyses for the Bartonella species identification. SVS and IS did the project management. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Sergio Villanueva-Saz or Ingo Schäfer.

Ethics declarations

Ethics approval and consent to participate

This survey was included under Project Licence PI75/20 approved by the Ethic Committee for Animal Experiments for the University of Zaragoza. The care and use of animals were performed according with the Spanish Policy for Animal Protection RD 53/2013, which meets the European Union Directive 2010/63 on the protection of animals used for experimental and other scientific purposes.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1: Fig. S1.

Maximum likelihood (ML) phylogenetic tree genepercentaged using the RAxML plugin in Geneious 10.1.3 software, calculated from the partial internal transcribed spacer (ITS) sequences of Bartonella species. Sequence data genepercentaged in the present study are highlighted in bold. Brucella melitensis was used as outgroup. Bootstrap values > 50% are shown at the nodes.

Additional file 2: Fig. S2.

Maximum likelihood (ML) phylogenetic tree genepercentaged using the RAxML plugin in Geneious 10.1.3 software, calculated from the partial 18S rRNA gene sequences of selected Hepatozoon species. Sequence data genepercentaged in the present study are highlighted in bold. Adelina dimidiata was used as outgroup. Bootstrap values > 50% are shown at the nodes.

Additional file 3: Fig. S3:

Average amount of rainfall sorted by months in the time frame of the study (blue line) and historically (red line) in Zaragoza (Spain)

Additional file 4: Fig. S4

: Average temperature sorted by months in the time frame of the study (blue line) and historically (red line) in Zaragoza (Spain).

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Villanueva-Saz, S., Martínez, M., Nijhof, A.M. et al. Molecular survey on vector-borne pathogens in clinically healthy stray cats in Zaragoza (Spain). Parasites Vectors 16, 428 (2023). https://doi.org/10.1186/s13071-023-06046-y

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13071-023-06046-y

Keywords

Parasites & Vectors

ISSN: 1756-3305

Contact us