Open Access

The mitochondrial genome of Paragyrodactylus variegatus (Platyhelminthes: Monogenea): differences in major non-coding region and gene order compared to Gyrodactylus

Parasites & Vectors20147:377

https://doi.org/10.1186/1756-3305-7-377

Received: 6 May 2014

Accepted: 4 August 2014

Published: 17 August 2014

Abstract

Background

Paragyrodactylus Gvosdev and Martechov, 1953, a viviparous genus of ectoparasite within the Gyrodactylidae, contains three nominal species all of which infect Asian river loaches. The group is suspected to be a basal lineage within Gyrodactylus Nordmann, 1832 sensu lato although this remains unclear. Further molecular study, beyond characterization of the standard Internal Transcribed Spacer region, is needed to clarify the evolutionary relationships within the family and the placement of this genus.

Methods

The mitochondrial genome of Paragyrodactylus variegatus You, King, Ye and Cone, 2014 was amplified in six parts from a single worm, sequenced using primer walking, annotated and analyzed using bioinformatic tools.

Results

The mitochondrial genome of P. variegatus is 14,517 bp, containing 12 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes, two ribosomal RNA (rRNA) genes and a major non-coding region (NCR). The overall A + T content of the mitochondrial genome is 76.3%, which is higher than all reported mitochondrial genomes of monogeneans. All of the 22 tRNAs have the typical cloverleaf secondary structure, except tRNACys, tRNASer1 and tRNASer2 that lack the dihydrouridine (DHU) arm. There are six domains (domain III is absent) and three domains in the inferred secondary structures of the large ribosomal subunit (rrnL) and small ribosomal subunit (rrnS), respectively. The NCR includes six 40 bp tandem repeat units and has the double identical poly-T stretches, stem-loop structure and some surrounding structure elements. The gene order (tRNAGln, tRNAMet and NCR) differs in arrangement compared to the mitochondrial genomes reported from Gyrodactylus spp.

Conclusion

The Duplication and Random Loss Model and Recombination Model together are the most plausible explanations for the variation in gene order. Both morphological characters and characteristics of the mitochondrial genome support Paragyrodactylus as a distinct genus from Gyrodactylus. Considering their specific distribution and known hosts, we believe that Paragyrodactylus is a relict freshwater lineage of viviparous monogenean isolated in the high plateaus of central Asia on closely related river loaches.

Keywords

Paragyrodactylus variegatus Mitochondrial genome Gyrodactylus Gyrodactylidae Monogenea Homatula variegata China

Background

Gyrodactylids are widespread parasites of freshwater and marine fishes, typically inhabiting the skin and gills of their hosts. Their direct life-cycle and hyperviviparous method of reproduction facilitates rapid population growth. Some species are pathogenic to their host (e.g. Gyrodactylus salaris Malmberg, 1957) [1] and capable of causing high host mortality resulting in serious ecological and economical consequences [2]. Over twenty genera and 400 species of gyrodactylids have been described [3], most of them being identified by comparative morphology of the opisthaptoral hard parts. This traditional approach for identification of gyrodactylids gives limited information for detailed phylogenetic analysis. Recently, the nuclear ribosomal DNA (rDNA) and the internal transcribed spacers (ITS) of rDNA have been incorporated into the molecular taxonomy of the group [4, 5]. In addition, mitochondrial markers (COI and COII) are also confirmed to be DNA barcoding for Gyrodactylus Nordmann, 1832 [6, 7]. But more polymorphic molecular markers suitable for different taxonomic categories are still needed for studying the taxonomy and phylogeny of these parasites.

Paragyrodactylus Gvosdev and Martechov, 1953 is a genus of Gyrodactylidae comprising three nominal species, Paragyrodactylus iliensis Gvosdev and Martechov, 1953 (=P. dogieli Osmanov, 1965), Paragyrodactylus barbatuli Ergens, 1970 and Paragyrodactylus variegatus You, King, Ye and Cone, 2014, all of which infect river loaches (Nemacheilidae) inhabiting streams in central Asia [8]. The relationship between Paragyrodactylus and Gyrodactylus has been recently explored. Kritsky and Boeger reported the two genera had a close relationship based on morphological characters [9]. Bakke et al. believed the complexity of the attachment apparatus separates Paragyrodactylus from Gyrodactylus and pondered whether these differences were fundamental or a local diversification within Gyrodactylus[3]. Furthermore, You et al., using morphology and molecular data, presented the hypothesis that Paragyrodactylus was a relict freshwater lineage of viviparous monogeneans isolated in the high plateaus of central Asia on river loaches [8]. The ambiguous relationship between Paragyrodactylus and Gyrodactylus emphasizes the need for further molecular study of these genera.

Due to its higher rate of base substitution, maternal inheritance, evolutionary conserved gene products and low recombination [10, 11], mitochondrial genomes provide powerful markers for phylogenetic analysis, biological identification and population studies. In addition, mitochondrial genomes can provide genome-level characters such as gene order for deep-level phylogenetic analysis [12, 13]. To date, the complete mitochondrial DNA sequences of only nine monogeneans are available, including three species of Gyrodactylus.

In the present study, the first mitochondrial genome for Paragyrodactylus, P. variegatus, is sequenced and characterized. We report on its genome organization, base composition, gene order, codon usage, ribosomal and transfer RNA gene features and major non-coding region. Additionally, we provide a preliminary comparison of the gene arrangement within both Paragyrodactylus and Gyrodactylus.

Methods

Specimen collection and DNA extraction

Specimens of P. variegatus were collected from the skin and fins of wild Homatula variegata (Dabry de Thiersant, 1874) in the Qinling Mountain region of central China. Upon capture the specimens were immediately preserved in 99% ethanol and stored at 4°C. The DNA from one parasite was extracted using a TIANamp Micro DNA Kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s protocol.

PCR and sequencing

The complete mitochondrial genome of P. variegatus was amplified in six parts using a combination of existing primers and newly developed primers generated by primer walking (primers listed in Table 1). For short fragments (<2 kb), PCR reactions were performed in a total volume of 25 μl, containing 3.0 mM MgCl2, 10 mM Tris–HCl (pH 8.3), 50 mM KCl, 0.25 mM of each dNTP , 1.25 U rTaq polymerase (TaKaRa, Dalian, China), 0.4 μM of each primer, 45 ng gDNA. Cycling conditions were: an initial denaturation for 1 min at 93°C, followed by 40 cycles of 10 sec at 92°C, 1.5 min at 52–54°C, 2 min at 60°C, and final extension of 6 min at 72°C. For long fragments (>2 kb), the 25 μl PCR reaction consisted of 2.5 mM MgCl2, 2.5 μl 10 × LA PCR Buffer II (Mg2+ free), 0.4 mM of each dNTP, 1.25 U LA Taq polymerase (TaKaRa, Dalian, China), 0.4 μM of each primer, 45 ng gDNA. Cycling conditions were: an initial denaturation for 1 min at 94°C, followed by 40 cycles of 20 sec at 93°C, 30 sec at 53–54°C, 4–7 min at 68°C, and final extension of 10 min at 68°C. All PCR products were purified with a PCR Purification Kit (Sangon Biotech, Shanghai, China) and sequenced using multiple primers including those which generated the PCR product and new internal primers developed by primer walking.
Table 1

List of PCR primer combinations used to amplify the mitochondrial genome of Paragyrodactylus variegatus

Primer name

Gene

Sequence(5′ – 3′)

Source

1 F(UND1F)*

ND1

CGHAAGGGNCCNAAHAAGGT

Huyse et al. (2007) [17]

1R*

COI

TAAACTTCTGGATGWCCAAAAAAT

This study

2 F(UNAD5F)

ND5

TTRGARGCNATGCGBGCHCC

Huyse et al. (2007) [17]

2R

COIII

YCARCCTGAGCGAATTCARGCKGG

This study

3 F(U12SF)*

rrnS

CAGTGCCAGCAKYYGCGGTTA

Huyse et al. (2007) [17]

3R(UNAD5R)*

ND5

GGWGCMCGCATNGCYTCYAA

Huyse et al. (2007) [17]

4 F

ND5

ATGTGATTTTTAGAGTTATGCTT

This study

4R(6RNAD5)

ND5

AGGHTCTCTAACTTGGAAAGWTAGTAT

Huyse et al. (2008) [24]

5 F*

COIII

TCTTCWRTTACAGYAACDTCCTA

This study

5R*

ND1

AAACCTCATACCTAACTGCG

This study

6 F*

COI

CTCCTTTATCTGGTGCTCTGGG

This study

6R*

rrnS

GACGGGCGGTATGTACCTCTCT

This study

F236

COIII

TTGTTTTTGATTCCGTGA

This study

F930

CYTB

TTATCTTTGTGGTTCGTTCG

This study

F1568

CYTB

AGGTCAAAGATAGGTGGGTTAG

This study

F2174

ND4

TATAGGAATTTTACCATTATTTA

This study

F2855

ND4

CATGGCTTATCAGTTTG

This study

F3302

tRNAGln

GGTAGCATAGGAGGTAAGGTTC

This study

F8330

COI

TTTAGCGGGTATTTCAAGTA

This study

F8920

COI

GTATTATTCACTATAGGAGGGGTA

This study

R4662

ATP6

ACGAAATAATAAAAATATAAAAAGT

This study

R5283

ND2

TCCAGAAACTAACAATAAAGCAC

This study

R6003

tRNAVal

ACCTAATGCTTGTAATG

This study

R6599

ND1

AAACCTCATACCTAACTGCG

This study

R7212

tRNAPro

GCAGCCCTATCAGTAAGACC

This study

R7941

COI

ACCAAGCCCTACAAAACCTG

This study

R10014

rrnL

TCCCCATTCAGACAATCCTC

This study

R10652

rrnS

GCTGGCACTGTGACTTATCCTA

This study

R11375

COII

ATTGTAGGTAAAAAGGTTCAC

This study

R12090

ND6

AAAAAGACAATAAGACCCACTA

This study

R12752

tRNALeu(UUR)

AACACTTTGTATTTGACGCT

This study

R14014

ND5

AGGTTCAAGTAATGGTAGGTCT

This study

*The PCR primers for the long PCR fragment (>2 kb).

Sequence analysis

Contiguous sequence fragments were assembled using SeqMan (DNAStar) and Staden Package v1.7.0 [14]. Protein-coding (PCGs) and ribosomal RNA (rRNA) genes were initially identified using BLAST (Basic Local Alignment Search Tool) searches on GenBank, then by alignment with the published mitochondrial genomes of Gyrodactylus derjavinoides Malmberg, Collins, Cunningham and Jalali, 2007 (GenBank no. EU293891), G. salaris (GenBank no. DQ988931) and Gyrodactylus thymalli Zitnan, 1960 (GenBank no. EF527269). The secondary structure of the two rRNA genes was determined mainly by comparison with the published rRNA secondary structures of Dugesia japonica Ichikawa and Kawakatsu, 1964 (GenBank no. NC_016439) [15]. Protein-coding regions were translated with the echinoderm mitochondrial genetic code. The program tRNAscan-SE v1.21 (http://lowelab.ucsc.edu/tRNAscan-SE/) was used to identify transfer RNA (tRNA) genes and their structures [16], using the mito/chloroplast codon and setting the cove cutoff score to one. The tRNAs, which were not detected by tRNA scan-SE v1.21, were identified by comparing the sequence to Gyrodactylus[17, 18]. Tandem Repeat Finder v4.07 was used to identify tandem repeats in non-coding regions [19]. The base composition, codon usage and genetic distance were calculated with MEGA v5.1 [20]. The nonsynonymous (Ka)/synonymous (Ks) values were estimated by the KaKs_Calculator v1.2 with the MA method [21].

Results

Genome organization, base composition and gene order

The circular mitochondrial genome of P. variegatus is 14,517 bp in size (GenBank no. KM067269) and contains 12 PCGs, 22 tRNAs, two rRNA and a single major non-coding region (NCR) (Figure 1). It lacks the ATP8 gene, and all the genes are transcribed from the same strand. The overall nucleotide composition is: T (45.8%), C (9.5%), A (30.4%), G (14.2%), with an overall A + T content of 76.3% (Table 2).
Figure 1

The gene map for the mitochondrial genome of Paragyrodactylus variegatus .

Table 2

Base composition of the mitochondrial genome of Paragyrodactylus variegatus

Genes

A%

T%

C%

G%

A + T%

Complete genome

30.4

45.8

9.5

14.2

76.3

Protein genes

27.8

47.9

9.5

14.8

75.7

rRNA genes

34.4

40.7

10.6

14.2

75.1

tRNA genes

32.6

40.8

10.8

15.8

73.5

Major non-coding region (NCR)

42.5

40.9

7.2

9.4

83.4

The arrangement of rRNA and protein coding genes of P. variegatus is typical for gyrodactylids. However, the gene order of some tRNA genes is different: there are three tRNAs (tRNAGln, tRNAPhe, tRNAMet) between ND4 and the major non-coding region and five tRNAs (tRNATyr, tRNALeu1, tRNASer2, tRNALeu2, tRNAArg) between ND6 and ND5 in P. variegatus, while Gyrodactylus spp. have one tRNA (tRNAPhe) and seven tRNAs (tRNATyr, tRNALeu1, tRNAGln, tRNAMet, tRNASer2, tRNALeu2, tRNAArg) in the same location, respectively.

Protein coding genes and codon usage

The total length of all 12 PCGs is 9,990 bp. The average A + T content of PCGs is 75.7% (Table 2), ranging from 70.9% (COI) to 82.9% (ND2). ATG is the typical start codon, except for ND1 and COII, which begins with GTG and TTG, respectively (Table 3). All PCGs terminate with the stop codons TAA, while ND5 uses the codon TAG. The incomplete stop codons were not observed in P. variegatus.
Table 3

The organization of the mitochondrial genome of Paragyrodactylus variegatus

Gene

Position

Size (bp)

Codon

Anticodon

Intergenic nucleotides

Form

To

Start

Stop

COIII

1

639

639

ATG

TAA

 

/

tRNA-His (H)

651

713

63

  

GTG

11

CYTB

719

1798

1080

ATG

TAA

 

5

ND4L

1803

2057

255

ATG

TAA

 

4

ND4

2030

3238

1209

ATG

TAA

 

-28

tRNA-Gln (Q)

3245

3311

67

  

TTG

6

tRNA-Phe (F)

3331

3397

67

  

GAA

19

tRNA-Met (M)

3410

3476

67

  

CAT

12

NCR

3477

4569

1093

   

0

ATP6

4570

5082

513

ATG

TAA

 

0

ND2

5084

5959

876

ATG

TAA

 

1

tRNA-Val (V)

5974

6040

67

  

TAC

14

tRNA-Ala (A)

6047

6112

66

  

TGC

6

tRNA-Asp (D)

6114

6178

65

  

GTC

1

ND1

6183

7073

891

GTG

TAA

 

4

tRNA-Asn (N)

7087

7155

69

  

GTT

13

tRNA-Pro (P)

7159

7221

63

  

TGG

3

tRNA-Ile (I)

7216

7283

68

  

GAT

-6

tRNA-Lys (K)

7288

7352

65

  

CTT

4

ND3

7361

7711

351

ATG

TAA

 

8

tRNA-Ser(AGN)(S1)

7726

7782

57

  

TCT

14

tRNA-Trp (W)

7792

7858

67

  

TCA

9

COI

7862

9409

1548

ATG

TAA

 

3

tRNA-Thr (T)

9418

9484

67

  

TGT

8

rrnL(16S)

9484

10443

960

   

-1

tRNA-Cys (C)

10444

10503

60

  

GCA

0

rrnS (12S)

10505

11216

712

   

1

COII

11223

11804

582

TTG

TAA

 

6

tRNA-Glu (E)

11955

12018

64

  

TTC

150

ND6

12025

12501

477

ATG

TAA

 

6

tRNA-Tyr (Y)

12507

12573

67

  

GTA

5

tRNA-Leu(CUN)(L1)

12585

12650

66

  

TAG

11

tRNA-Ser(UCN)(S2)

12657

12716

60

  

TGA

6

tRNA-Leu(UUR)(L2)

12719

12788

70

  

TAA

2

tRNA-Arg (R)

12794

12860

67

  

TCG

5

ND5

12865

14433

1569

ATG

TAG

 

4

tRNA-Gly (G)

14446

14513

68

  

TCC

12

The codon usage and relative synonymous codon usage (RSCU) values are summarized (Table 4). The most frequent amino acids in the PCGs of P. variegatus are as follows: Leucine (16.43%), Phenylalanine (13.23%), Serine (12.48%), and Isoleucine (10.67%). The frequency of Glutamine is especially low (0.69%). The codons TTA (Leucine; 12.09%) and TTT (Phenylalanine; 11.48%) are the most frequently used codons. For the third position of the fourfold degenerate amino acid, codons ending with T are the most frequent.
Table 4

Codon usage for the 12 mitochondrial proteins of Paragyrodactylus variegatus

Codon(AA)

N

%

RSCU

Codon(AA)

N

%

RSCU

UUU(F)

381

11.48

1.74

UAU(Y)

180

5.42

1.72

UUC(F)

58

1.75

0.26

UAC(Y)

29

0.87

0.28

UUA(L)

401

12.09

4.41

UAA(*)

0

0.00

0

UUG(L)

39

1.18

0.43

UAG(*)

0

0.00

0

CUU(L)

68

2.05

0.75

CAU(H)

45

1.36

1.7

CUC(L)

7

0.21

0.08

CAC(H)

8

0.24

0.3

CUA(L)

27

0.81

0.3

CAA(Q)

14

0.42

1.22

CUG(L)

3

0.09

0.03

CAG(Q)

9

0.27

0.78

AUU(I)

175

5.27

1.48

AAU(N)

103

3.10

1.67

AUC(I)

11

0.33

0.09

AAC(N)

18

0.54

0.29

AUA(I)

168

5.06

1.42

AAA(N)

64

1.93

1.04

AUG(M)

68

2.05

1

AAG(K)

48

1.45

1

GUU(V)

150

4.52

2.4

GAU(D)

54

1.63

1.59

GUC(V)

8

0.24

0.13

GAC(D)

14

0.42

0.41

GUA(V)

81

2.44

1.3

GAA(E)

37

1.12

1.32

GUG(V)

11

0.33

0.18

GAG(E)

19

0.57

0.68

UCU(S)

114

3.44

2.2

UGU(C)

65

1.96

1.83

UCC(S)

9

0.27

0.17

UGC(C)

6

0.18

0.17

UCA(S)

65

1.96

1.26

UGA(W)

58

1.75

1.55

UCG(S)

3

0.09

0.06

UGG(W)

17

0.51

0.45

CCU(P)

38

1.15

2.03

CGU(R)

33

0.99

3

CCC(P)

2

0.06

0.11

CGC(R)

4

0.12

0.36

CCA(P)

34

1.02

1.81

CGA(R)

5

0.15

0.45

CCG(P)

1

0.03

0.05

CGG(R)

2

0.06

0.18

ACU(T)

58

1.75

2.37

AGU(S)

104

3.13

2.01

ACC(T)

9

0.27

0.37

AGC(S)

12

0.36

0.23

ACA(T)

30

0.90

1.22

AGA(S)

81

2.44

1.57

ACG(T)

1

0.03

0.04

AGG(S)

26

0.78

0.5

GCU(A)

33

0.99

1.97

GGU(G)

90

2.71

2.05

GCC(A)

7

0.21

0.42

GGC(G)

18

0.54

0.41

GCA(A)

25

0.75

1.49

GGA(G)

46

1.39

1.05

GCG(A)

2

0.06

0.12

GGG(G)

22

0.66

0.5

A total of 3318 codons for P. variegatus were analyzed, excluding the stop codons. AA, amino acid; N, number of used codon; % = N/3318; RSCU, relative synonymous codon usage.

Ribosomal and transfer RNA genes

The length of large ribosomal subunit (rrnL) and small ribosomal subunit (rrnS) genes of P. variegatus are 960 bp and 712 bp, respectively (Table 3). The A + T contents of the rrnL and rrnS of P. variegatus are 75.0% and 75.3%, respectively. The predicted secondary structure of rrnL and rrnS of P. variegatus is shown in Figure 2 and Figure 3. The secondary structures of these regions contain six and three structural domains, respectively. But domain I of the rrnL lacks a large region at the 5′ end gene, and the domain III is absent in the secondary structure of rrnL of P. variegatus.
Figure 2

Inferred secondary structure of the mitochondrial rrnL gene for Paragyrodactylus variegatus .

Figure 3

Inferred secondary structure of the mitochondrial rrnS gene for Paragyrodactylus variegatus .

The 22 tRNA genes of P. variegatus vary in length from 57 to 70 nucleotides. Sequences of tRNAIle and tRNAThr genes overlap with neighboring genes (Table 3). All of the 22 tRNAs have the typical cloverleaf secondary structure, except for tRNACys, tRNASer1 and tRNASer2 in which each have unpaired dihydrouridine (DHU) arm.

Synonymous and nonsynonymous substitutions and genetic distance

The Ka/Ks values for all 12 PCGs of P. variegatus versus Gyrodactylus spp. are presented, which all are less than 0.3. The highest average Ka/Ks value is ND2 (0.29), while the Ka/Ks ratios of half the PCGs are low (Ka/Ks < 0.1). The genetic distance between P. variegatus and the three reported species of Gyrodactylus (G. thymalli, G. salaris and G. derjavinoides) are much greater than among the three species of Gyrodactylus (Figure 4). The maximum divergence occurs in ND5 gene (48.9%) between P. variegatus and G. salaris. In addition, the genetic distances of rRNA genes are lower than protein genes (Figure 4).
Figure 4

The genetic distance of protein and rRNA genes of Paragyrodactylus variegatus and Gyrodactylus spp.

Non-coding regions

The major non-coding region is 1,093 bp in size, which is highly enriched in AT (83.4%). This non-coding region can be subdivided into six parts including three junctions by the sequence pattern (Figure 5). The sequence of part I and part II is homologous with 81.7% sequence identity. Part III contains six identical repeat units of 40 bp sequence with some sequence modifications: one substitution at the fifth position (the initial repeat unit), three substitutions at the 223rd, 227th and 237th positions and two insertions at the 222nd and 225th positions (the terminal repeat unit). The repeat unit of part III was able to fold into a stem-loop secondary structure. Some predicted structural elements were also found in the sequence of part I and II (Figure 6). In addition, 30 short non-coding regions, all < 151 bp, occur in the mitochondrial genome of P. variegatus (Table 3).
Figure 5

Organization of the mitochondrial major non-coding region of Paragyrodactylus variegatus .

Figure 6

Predicted structural elements for the mitochondrial major non-coding region of Paragyrodactylus variegatus . ‘(G)’ is the variation in the identical pattern of part II.

Discussion

Characteristics of the mitochondrial genome

The mitochondrial genome of P. variegatus is 222 bp shorter than that of G. derjavinoides, but well within the length range of parasitic flatworms [22, 23]. Differing number and length of the major non-coding region is the main factor that contributes to this difference in genome size. The overall A + T content of P. variegatus is higher than that of all reported mitochondrial genomes of monogeneans. The average Ka/Ks values of genes encoding 3 subunits of cytochrome c oxidase and the cytochrome b subunit of cytochrome bc1 complex are lower than genes encoding subunits of the NADH dehydrogenase complex (with the exception of ND1), especially COI and Cytb genes. This feature demonstrates COI, COII, COIII and Cytb genes are more strongly effected by purifying selection pressure compared to subunits of the NADH dehydrogenase genes (except ND1), which is similar to the findings of Huyse et al. [24] for Gyrodactylus derjavinoides. The degree of functional constraints might be a reason for corresponding degree sequence variations of protein genes. The low Ka/Ks values and genetic distance of COI and Cytb genes also imply that both genes could be used as a useful marker for analyses at higher taxonomic levels. Although sizes of rrnL and rrnS are very similar among Gyrodactylus spp. and P. variegatus, the sequence similarities are not high. These discrepancies may reflect the variable helices or loops that exist in the rRNA structure.

The major non-coding region

The mitochondrial genome of P. variegatus includes one major non-coding region, which has been frequently observed in other invertebrates. It contains a high A + T content and tandem repeat sequences which could not be found in large non-coding regions (>500 bp) of the published mitochondrial genomes of monopisthocotyleans. We found that length and number of tandem repeat units are similar to those observed in Microcotyle sebastis Goto, 1894 [25], contradicting the study of Zhang et al.[26] that reported the length and number of repeated motifs were different in the mitochondrial non-coding regions of monopisthocotylids and polyopisthocotylids.

A non-coding region with high A + T content and pertinent elements usually corresponds to the control region for replication and transcription initiation. In the major non-coding region of P. variegatus, we found identical patterns within part I and part II. The patterns have only two nucleotide modifications with 2.3% sequence discrepancy; however, the overall difference between the whole sequence of part I and part II is 18.3%. The highly conserved part of the non-coding region is believed to have a functional role. The patterns contain poly-T stretches, a stem-loop structure and some surrounding structure elements (A + T-rich segment and G[A]nT) (Figure 6) which are typical of control regions in insects [2730]. Although typical control regions are not readily identifiable within the mitochondrial genome of flatworms [17], the predicted secondary structure, conserved element, repeat sequences and high A + T content of major non-coding region in P. variegatus implies that this region might play an important role in the initiation of replication and transcription.

In addition, through alignment of non-coding regions sequences between Gyrodactylus spp. and P. variegatus, we found some conserved motifs in each species with the overall similarity among them being 72.1%. The conserved motifs (>5 bp) mainly existed in the A + T-rich segment and G + A-rich segment. However, whether or not the conserved motifs are present in other species of Gyrodactylidae needs to be assessed with a broader taxon sample.

Gene arrangements and possible evolutionary mechanisms

Five available mitochondrial gene arrangements of monopisthocotylids are shown in Figure 7. The arrangement of all rRNA and protein coding genes are identical throughout all samples, however, the tRNA genes differ in arrangement showing some translocation, particularly long-range translocation. No notable rearrangement hot spot could be found in gene arrangements of monopisthocotylids, however, the major change of gene arrangement among polyopisthocotylids is limited in the COIII-ND5 junction as a gene rearrangement hot spot [26]. Two gene clusters (tRNAAsn-tRNAPro-tRNAIle-tRNALys and rrnL-tRNACys-rrnS) were found to be conserved in all mitochondrial genomes of monopisthocotyleans. Nevertheless, the tRNALys and tRNACys were found in the gene rearrangement hot spot of polyopisthocotyleans. The conserved gene clusters could potentially be a marker used to help define the Polyopisthocotylea and Monopisthocotylea within the monogenea, as well as providing information for a deeper understanding of the evolution of monogenean mitochondrial genomes.
Figure 7

Gene arrangements of ten monogenean species. Gene and genome size are not to scale. All genes are transcribed in the same direction (form left to right). Red and black box shows the conserved gene cluster and gene rearrangement hot spot, respectively. The non-coding region (>500 bp) is denoted by the NCR. The same gene arrangement of three Gyrodactylus species (G. salaris, G. derjavinoides and G. thymalli) is shown as Gyrodactylus spp.

Gene rearrangement can be mainly explained by three mechanisms: Duplication and Random Loss Model [31, 32], Duplication and Nonrandom Loss Model [33] and Recombination Model [34]. The variation (tRNAGln, tRNAMet and NCR) of mitochondrial gene order occurring between P. variegatus and Gyrodactylus spp. could be explained by the duplication and random loss model and recombination model together with the parsimonious scenario. We assume that the process contains three steps: one tandem duplication, random loss, followed by intramitochondrial recombination (Figure 8). We prefer this mechanism for the following reasons: the duplicate NCRs in the mitochondrial genomes of most metazoans can be explained by the duplication and random loss model, but the stepwise mechanism described above is more appropriate to interpret the duplicated NCRs and long-range translocation, meanwhile the rest of the genes remain in their original state. Furthermore, there are several examples of mitochondrial recombination in animals [3538], and a similar mechanism accounts for the gene rearrangement of other metazoans [39, 40]. In addition, the tRNAMet genes of Gyrodactylus spp. are clearly homologous to the tRNAMet gene of P. variegatus with 80.6% sequence similarity. However, the tRNAGln region does have low sequence similarity (66.2%) between the mitochondrial genomes of Gyrodactylus spp. and P. variegatus, so we cannot be certain that the translocation event happened. As more mitochondrial genomes of gyrodactylids become available, all of the above hypotheses should be tested with respect to gene orders.
Figure 8

Possible mechanism of mitochondrial gene rearrangements occurring in Paragyrodactylus variegatus and Gyrodactylus spp.

Conclusions

The characteristics of the mitochondrial genome of P. variegatus are notably different from Gyrodactylus spp., including the gene order, which is similar to other monopisthocotylids. The overall average genetic distance between Paragyrodactylus and Gyrodactylus based on the rRNA and 12 protein coding genes is remarkably greater than within Gyrodactylus. All of these features support Paragyrodactylus as a distinct genus. Considering their specific distribution and hosts, we tend towards the view of You et al.[8] that Paragyrodactylus is a relict freshwater lineage of viviparous monogenean isolated in the high plateaus of central Asia on closely related river loaches.

Declarations

Acknowledgments

The authors would like to thank Dr. Yuan Huang (College of Life Science, Shaanxi Normal University) for assistance with the analytic software. This research was supported by the National Natural Science Foundation of China (31372158).

Authors’ Affiliations

(1)
Co-Innovation Center for Qinba regions’ sustainable development, College of Life Science, Shaanxi Normal University
(2)
Department of Biology, Dalhousie University
(3)
Department of Biology, Saint Mary’s University

References

  1. Johnsen BO, Jensen AJ: The Gyrodactylus story in Norway. Aquaculture. 1991, 98: 289-302. 10.1016/0044-8486(91)90393-L.View ArticleGoogle Scholar
  2. Mo TA, Norheim K: The surveillance and control programme for Gyrodactylus salaris in Atlantic salmon and rainbow trout in Norway. Annual Report 2004. 2005, Oslo, Norway: National Veterinary Institute, 137-139.Google Scholar
  3. Bakke TA, Cable J, Harris PD: The biology of gyrodactylid monogeneans: the “Russian Doll-killers”. Adv Parasitol. 2007, 64: 161-376.View ArticlePubMedGoogle Scholar
  4. Ziętara MS, Huyse T, Lumme J, Volckaert FA: Deep divergence among subgenera of Gyrodactylus inferred from rDNA ITS region. Parasitology. 2002, 124: 39-52.PubMedGoogle Scholar
  5. Matejusová I, Gelnar M, Verneau O, Cunningham CO, Littlewood DTJ: Molecular phylogenetic analysis of the genus Gyrodactylus (Platyhelminthes : Monogenea) inferred from rDNA ITS region: subgenera versus species groups. Parasitology. 2003, 127: 603-611. 10.1017/S0031182003004098.View ArticlePubMedGoogle Scholar
  6. Vanhove MPM, Tessens B, Schoelinck C, Jondelius U, Littlewood DTJ, Artois T, Huyse T: Problematic barcoding in flatworms: A case-study on monogeneans and rhabdocoels (Platyhelminthes). Zookeys. 2013, 365: 355-379.View ArticlePubMedGoogle Scholar
  7. Bueno-Silva M, Boeger WA: Neotropical Monogenoidea. 58. Three new species of Gyrodactylus (Gyrodactylidae) from Scleromystax spp. (Callichthyidae) and the proposal of COII gene as an additional fragment for barcoding gyrodactylids. Folia Parasitol. 2014, 61: 213-222. 10.14411/fp.2014.028.View ArticlePubMedGoogle Scholar
  8. You P, King SD, Ye F, Cone DK: Paragyrodactylus variegatus n. sp. (Gyrodactylidae) from Homatula variegata (Dabry de Thiersant, 1874) (Nemacheilidae) in central China. J Parasitol. 2014, 100: 350-355. 10.1645/13-257.1.View ArticlePubMedGoogle Scholar
  9. Kritsky DC, Boeger WA: Phylogeny of the Gyrodactylidae and the phylogenetic status of Gyrodactylus Nordmann, 1832 (Platyhelminthes: Monogenoidea). Taxonomy, ecology and evolution of metazoan parasites (Livre hommage à Louis Euzet). Edited by: Tome II, Combes C, Jourdane J. 2003, Perpignan, France: Presses Universitaire Perpignan, 37-58.Google Scholar
  10. Elson JL, Lightowlers RN: Mitochondrial DNA clonality in the dock: can surveillance swing the case?. Trends Genet. 2006, 22: 603-607. 10.1016/j.tig.2006.09.004.View ArticlePubMedGoogle Scholar
  11. Gissi C, Iannelli F, Pesole G: Evolution of the mitochondrial genome of Metazoa as exemplified by comparison of congeneric species. Heredity. 2008, 101: 301-320. 10.1038/hdy.2008.62.View ArticlePubMedGoogle Scholar
  12. Lavrov DV, Lang BF: Poriferan mtDNA and animal phylogeny based on mitochondrial gene arrangements. Syst Biol. 2005, 54: 651-659. 10.1080/10635150500221044.View ArticlePubMedGoogle Scholar
  13. Boore JL, Brown WM: Big trees from little genomes: mitochondrial gene order as a phylogenetic tool. Curr Opin Genet Dev. 1998, 8: 668-674. 10.1016/S0959-437X(98)80035-X.View ArticlePubMedGoogle Scholar
  14. Staden R, Beal KF, Bonfield JK: The Staden package, 1998. Methods in Molecular Biology. Bioinformatics Methods and Protocols. Edited by: Misener S, Krawetz SA. 1998, Totowa, NJ: The Humana Press Inc, 115-130.Google Scholar
  15. Sakai M, Sakaizumi M: The complete mitochondrial genome of Dugesia japonica (Platyhelminthes; Order Tricladida). Zoolog Sci. 2012, 29: 672-680. 10.2108/zsj.29.672.View ArticlePubMedGoogle Scholar
  16. Lowe TM, Eddy SR: tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997, 25: 955-964. 10.1093/nar/25.5.0955.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Huyse T, Plaisance L, Webster BL, Mo TA, Bakke TA, Bachmann L, Littlewood DTJ: The mitochondrial genome of Gyrodactylus salaris (Platyhelminthes: Monogenea), a pathogen of Atlantic salmon (Salmo salar). Parasitology. 2007, 134: 739-747. 10.1017/S0031182006002010.View ArticlePubMedGoogle Scholar
  18. Plaisance L, Huyse T, Littlewood DTJ, Bakke TA, Bachmann L: The complete mitochondrial DNA sequence of the monogenean Gyrodactylus thymalli (Platyhelminthes: Monogenea), a parasite of grayling (Thymallus thymallus). Mol Biochem Parasitol. 2007, 154: 190-194. 10.1016/j.molbiopara.2007.04.012.View ArticlePubMedGoogle Scholar
  19. Benson G: Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999, 27: 573-580. 10.1093/nar/27.2.573.PubMed CentralView ArticlePubMedGoogle Scholar
  20. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011, 28: 2731-2739. 10.1093/molbev/msr121.PubMed CentralView ArticlePubMedGoogle Scholar
  21. Zhang Z, Li J, Zhao XQ, Wang J, Wong GK, Yu J: KaKs_Calculator: calculating Ka and Ks through model selection and model averaging. Genomics Proteomics Bioinformatics. 2006, 4: 259-263. 10.1016/S1672-0229(07)60007-2.View ArticlePubMedGoogle Scholar
  22. Le TH, Humair PF, Blair D, Agatsuma T, Littlewood DTJ, McManus DP: Mitochondrial gene content, arrangement and composition compared in African and Asian schistosomes. Mol Biochem Parasitol. 2001, 117: 61-71. 10.1016/S0166-6851(01)00330-9.View ArticlePubMedGoogle Scholar
  23. Le TH, Blair D, McManus DP: Mitochondrial genomes of parasitic flatworms. Trends Parasitol. 2002, 18: 206-213. 10.1016/S1471-4922(02)02252-3.View ArticlePubMedGoogle Scholar
  24. Huyse T, Buchmann K, Littlewood DTJ: The mitochondrial genome of Gyrodactylus derjavinoides (Platyhelminthes: Monogenea) - a mitogenomic approach for Gyrodactylus species and strain identification. Gene. 2008, 417: 27-34. 10.1016/j.gene.2008.03.008.View ArticlePubMedGoogle Scholar
  25. Park JK, Kim KH, Kang S, Kim W, Eom KS, Littlewood DTJ: A common origin of complex life cycles in parasitic flatworms: evidence from the complete mitochondrial genome of Microcotyle sebastis (Monogenea: Platyhelminthes). BMC Evol Biol. 2007, 7: 11-10.1186/1471-2148-7-11.PubMed CentralView ArticlePubMedGoogle Scholar
  26. Zhang J, Wu X, Xie M, Li A: The complete mitochondrial genome of Pseudochauhanea macrorchis (Monogenea: Chauhaneidae) revealed a highly repetitive region and a gene rearrangement hot spot in Polyopisthocotylea. Mol Biol Rep. 2012, 39: 8115-8125. 10.1007/s11033-012-1659-z.View ArticlePubMedGoogle Scholar
  27. Goddard JM, Wolstenholme DR: Origin and direction of replication in mitochondrial DNA molecules from the genus Drosophila. Nucleic Acids Res. 1980, 8: 741-757.PubMed CentralPubMedGoogle Scholar
  28. Zhang DX, Szymura JM, Hewitt GM: Evolution and structure conservation of the control region of insect mitochondrial DNA. J Mol Evol. 1995, 40: 382-391. 10.1007/BF00164024.View ArticlePubMedGoogle Scholar
  29. Zhang DX, Hewitt GM: Insect mitochondrial control region: a review of its structure, evolution and usefulness in evolutionary studies. Biochem Syst Ecol. 1997, 25: 99-120. 10.1016/S0305-1978(96)00042-7.View ArticleGoogle Scholar
  30. Wei SJ, Shi M, Chen XX, Sharkey MJ, Achterberg CV, Ye GY, He JH: New views on strand asymmetry in insect mitochondrial genomes. PLoS One. 2010, 5: e12708-10.1371/journal.pone.0012708.PubMed CentralView ArticlePubMedGoogle Scholar
  31. Moritz C, Brown WM: Tandem duplications in animal mitochondrial DNAs: variation in incidence and gene content among lizards. Proc Natl Acad Sci USA. 1987, 84: 7183-7187. 10.1073/pnas.84.20.7183.PubMed CentralView ArticlePubMedGoogle Scholar
  32. Boore JL: The duplication/random loss model for gene rearrangement exemplified by mitochondrial genomes of deuterostome animals. Computational biology series. Vol. 1. Dordrecht (The Netherlands). Edited by: Sankoff D, Nadeau J. 2000, Dordrecht, Boston, and London: Kluwer Academic Publishers, 133-147.Google Scholar
  33. Lavrov DV, Boore JL, Brown WM: Complete mtDNA sequences of two millipedes suggest a new model for mitochondrial gene rearrangement: duplication and nonrandom loss. Mol Biol Evol. 2002, 19: 163-169. 10.1093/oxfordjournals.molbev.a004068.View ArticlePubMedGoogle Scholar
  34. Dowton M, Campbell NJH: Intramitochondrial recombination - is it why some mitochondrial genes sleep around?. Trends Ecol Evol. 2001, 16: 269-271. 10.1016/S0169-5347(01)02182-6.View ArticlePubMedGoogle Scholar
  35. Thyagarajan B, Padua RA, Campbell C: Mammalian mitochondria possess homologous DNA recombination activity. J Biol Chem. 1996, 271: 27536-27543. 10.1074/jbc.271.44.27536.View ArticlePubMedGoogle Scholar
  36. Lunt DF, Hyman BC: Animal mitochondrial DNA recombination. Nature. 1997, 387: 247-10.1038/387247a0.View ArticlePubMedGoogle Scholar
  37. Rawson PD: Nonhomologous recombination between the large unassigned region of the male and female mitochondrial genomes in the mussel, Mytilus trossulus. J Mol Evol. 2005, 61: 717-732. 10.1007/s00239-004-0035-6.View ArticlePubMedGoogle Scholar
  38. Tsaousis AD, Martin DP, Ladoukakis ED, Posada D, Zouros E: Widespread recombination in published animal mtDNA sequences. Mol Biol Evol. 2005, 22: 925-933. 10.1093/molbev/msi084.View ArticlePubMedGoogle Scholar
  39. Chen WJ, Bu Y, Carapelli A, Dallai R, Li S, Yin WY, Luan YX: The mitochondrial genome of Sinentomon erythranum (Arthropoda: Hexapoda: Protura): an example of highly divergent evolution. BMC Evol Biol. 2011, 11: 246-10.1186/1471-2148-11-246.PubMed CentralView ArticlePubMedGoogle Scholar
  40. Kurabayashi A, Sumida M, Yonekawa H, Glaw F, Vences M, Hasegawa M: Phylogeny, recombination, and mechanisms of stepwise mitochondrial genome reorganization in mantellid frogs from Madagascar. Mol Biol Evol. 2008, 25: 874-891. 10.1093/molbev/msn031.View ArticlePubMedGoogle Scholar

Copyright

© Ye et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Advertisement