Skip to content

Advertisement

  • Research
  • Open Access

The complete mitochondrial genome of the gullet worm Gongylonema pulchrum: gene content, arrangement, composition and phylogenetic implications

Contributed equally
Parasites & Vectors20158:100

https://doi.org/10.1186/s13071-015-0697-5

  • Received: 28 October 2014
  • Accepted: 26 January 2015
  • Published:

Abstract

Background

Gongylonema pulchrum (Nematoda: Gongylonematidae), a thread-like spirurid gullet worm, infects a range of mammalian definitive hosts, including cattle, pigs, equines, goats, primates and humans, and can cause gongylonemiasis.

Methods

In the present study, the complete mitochondrial (mt) genome of G. pulchrum was obtained using Long-range PCR and subsequent primer walking. The phylogenetic position of G. pulchrum within the Spiruromorpha was established using Bayesian analyses of the protein-coding genes at the amino acid level.

Results

The length of this AT-rich (75.94%) mt genome is 13,798 bp. It contains 12 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes and one non-coding region. The gene arrangement is the same as those of Thelazia callipaeda (Thelaziidae) and Setaria digitata (Onchocercidae), but distinct from that of Heliconema longissimum (Physalopteridae). Phylogenetic analyses, based on the concatenated amino acid sequence data for all 12 protein-coding genes using Bayesian inference (BI) method, showed that G. pulchrum (Gongylonematidae) was more closely related to Spirocerca lupi (Spiruroidea) than other members of the infraorder Spiruromorpha.

Conclusions

The present study represents the first mt genome sequence for the family Gongylonematidae, which provides the opportunity to develop novel genetic markers for studies of epidemiology, population genetics and systematics of this nematode of human and animal health significance.

Keywords

  • Gongylonema pulchrum
  • Gongylonemiasis
  • Mitochondrial genome
  • Phylogenetic analyses

Background

Gongylonema pulchrum Molin, 1857, known as the ‘gullet worm’ because of its location in the upper digestive system of its definitive hosts, has a worldwide distribution and is responsible for gongylonemiasis of humans, sometimes causing serious complaints, e.g., expectoration of blood, numbness of tongue, vomiting, pharyngitis and stomatitis [1]. G. pulchrum also infects domestic and wild animal hosts, including bears, camels, cattle, cervids, donkeys, equines, goats, non-human primates, pigs, and sheep, causing major economic losses [2]. Fortunately, gongylonemiasis can be treated effectively using anthelmintics, such as levamisole, mebendazole and ivermectin [3].

Human gongylonemiasis, a neglected parasitic disease, has been reported from many countries (e.g., Australia, Bulgaria, Ceylon, China, France, Germany, Hungary, Iran, Japan, Laos, Morocco, New Zealand, Soviet Union, Spain, Sri Lanka, Turkey and USA). Recently, human gongylonemiasis has frequently been reported from China [4], France [5,6] and USA [7]. Clearly, the increased frequency and more widespread occurrence of clinical cases of human gongylonemiasis mean that knowledge on enhanced diagnosis, treatment and control is needed. Although molecular markers in portion of mitochondrial (mt) DNA and the internal transcribed spacer (ITS) regions of nuclear ribosomal DNA (rDNA), have found utility for taxonomic and epidemiological studies of G. pulchrum [8], there is still a paucity of information on G. pulchrum in different hosts and countries around the world.

Due to its maternal inheritance, fast rate of evolutionary change, lack of recombination and relatively conserved genome structures [9], mt genomes have been widely used as genetic markers for population genetic structure and the study of phylogenetic relationships among nematodes and trematodes [10]. In particular, concatenated amino acid sequences, derived from the protein-coding genes, lend themselves for assessing systematic relationships of parasitic nematodes [11-19]. The objectives of the present study were to characterize the mt genome of G. pulchrum, the first representative of the family Gongylonematidae, and to assess the phylogenetic position of this zoonotic nematode in relation to other nematodes of the infraorder Spiruromorpha.

Methods

Ethics statement

The performance of this study was strictly according to the recommendations of the Guide for the Care and Use of Laboratory Animals of the Ministry of Health, China, and our protocol was reviewed and approved by the Research Ethics Committee of Northwest A&F University.

Parasite collection

Adult specimens of G. pulchrum were collected from the oesophagus of a naturally infected goat in Shenmu, Shaanxi province, China, with no specific permits being required by the authority for the sample collection.

Genomic DNA extraction

The gullet worms were washed extensively in physiological saline, identified morphologically to species according to existing keys and descriptions [20], fixed in ethanol and then stored at −20°C until use. The mid-body section of each worm was used for the isolation of total genomic DNA using proteinase K digestion and mini-column purification (TIANamp Genomic DNA Purification System, TIANGEN). The identity of the specimen was verified by sequencing regions of the ITS-1 and ITS-2 rDNA using an established method [8]; the two regions were 99.7% and 100% identical to previously published sequences for G. pulchrum from Bos taurus in Iran (GenBank accession nos. AB495392 and AB513721, respectively).

Long-PCR and sequencing

Using three pairs of specific primers (Table 1) designed according to relatively conserved regions within the cox1, cox2 and cox3 regions of nematodes within order Spirurata (Figure 1), three overlapping amplicons of the complete mt genome were amplified by Long-PCR [21]. PCRs were conducted in 25 μl reaction volumes containing 2 mM MgCl2, 0.2 mM each of dNTPs, 2.5 μl 10× Taq buffer, 2.5 μM of each primer and 0.5 μl LA Taq DNA polymerase (5 U/μl, TaKaRa). PCR cycling conditions were as follows: 92°C for 2 min (initial denaturation), then 92°C for 10 s (denaturation), 45°C for 30 s (annealing), and 60°C for 8 min (extension) for 9 cycles, followed by 92°C for 10 s, 45°C for 30 s (annealing), and 60°C for 9 min (extension) for 25 cycles, with a cycle elongation of 10 s for each cycle and a final extension at 60°C for 10 min. No-template and known-positive controls were included in each run. Amplicons were column-purified using TIANgel Midi Purification Kit (TIANGEN, Beijing, China). Following an electrophoretic analysis of quality, purified amplicons were sequenced using a primer walking strategy [21] with primers listed in Additional file 1 by Invitrogen Company (Shanghai, China).
Table 1

Primers used to amplify the mitochondrial genome of Gongylonema pulchrum in three overlapping long PCR fragments

Name of primer

Sequence (5′ to 3′)

Extension positions

Product lengths

cox3—cox2

   

GPcox3u

TATGATATATCTATTGATTATTG

4162

3954 bp

GPcox2d

GCATCCATCTTAATAAAACACTTAGG

  

cox2—cox1

   

GPcox2u

GAGGTCGATAATCGTTGTATTATCCCTGTGG

8013

7155 bp

GPcox1d

AAGAATGAATAACATCCGAAGAAGT

cox1 —cox3

   

GPcox1u

TTTGGGGCTCCTGAGGTTTATA

770

3953 bp

GPcox3d

CAGAAATCTCTTCCATCACCTCGAT

Figure 1
Figure 1

Organization of the mitochondrial genome of Gongylonema pulchrum . Scale is approximate. All genes have standard nomenclature except for the 22 tRNA genes, which are designated by the one-letter code for the corresponding amino acid, with numerals differentiating each of the two leucine- and serine-specifying tRNAs (L1 and L2 for codon families CUN and UUR, respectively; S1 and S2 for codon families UCN and AGN, respectively). All genes are transcribed in the clockwise direction. ‘AT’ indicates the non-coding region.

Sequence analyses

Sequences were assembled manually and aligned against the complete mt genome sequences of Spirocerca lupi [22] using the computer program MAFFT 7.122 [23] to identify gene boundaries. Each gene was translated into its amino acid sequence using the invertebrate mitochondrial genetic code in MEGA 5 [24]. The translation initiation and termination codons were identified to avoid gene overlap and to optimize the similarity between the gene lengths of closely related species of the infraorder Spiruromorpha. The program tRNAscan-SE [25] was used to find tRNA and infer their secondary structure, putative secondary structures of 19 tRNA genes were identified, and the remaining three tRNA genes (tRNA-Arg, tRNA-Ser AGN and tRNA-Ser UCN) were inferred by recognizing potential secondary structures and anticodon sequences by eye [26]. Two rRNA genes were predicted by comparison with those of closely related nematodes of the infraorder Spiruromorpha [15,22].

Phylogenetic analyses

Amino acid sequences inferred from published mt genomes representing 12 species of the infraorder Spiruromorpha (Brugia malayi: GenBank accession no. NC_004298; Wuchereria bancrofti: JN367461; Chandlerella quiscali: NC_014486; Loa loa: NC_016199; Acanthocheilonema viteae: NC_016197; Onchocerca flexuosa: NC_016172; Onchocerca volvulus: AF015193; Dirofilaria immitis: NC_005305; Setaria digitata: NC_014282; S. lupi: KC305876; Thelazia callipaeda: JX069968; Heliconema longissimum: NC_016127) were included in the present analysis, using Toxascaris leonina (NC_023504) as the outgroup [27]. 12 amino acid sequences were separately aligned using MAFFT 7.122 and then concatenated, with ambiguously aligned regions excluded using Gblocks 0.91b (doc) [28] with the default parameters using the options for a less stringent selection. Phylogenetic analyses were conducted using Bayesian inference (BI) method. The JTT+G+F model of amino acid evolution was selected as the most suitable model of evolution by ProtTest 2.4 [29] based on the Akaike information criterion (AIC). As the JTT model is not implemented in the current version of MrBayes, an alternative model, CpREV, was used in BI and four chains (three heated and one cold) were run simultaneously for the Monte Carlo Markov Chain. Two independent runs for 1,000,000 metropolis-coupled MCMC generations were used, sampling a tree every 100 generation in MrBayes 3.1.1 [30]. At the end of each run, the average standard deviation of split frequencies was less than 0.01. In addition, the potential scale reduction factor (~1) was examined to ensure that the convergence had been achieved. A 50% majority rule consensus tree was obtained from BI. Of 10,000 trees, the first 2,500 trees represented burn-in and the remaining trees were used to calculate Bayesian posterior probabilities (Bpp). Phylograms were drawn using the program FigTree v.1.4 [31].

Results and discussion

The complete mt genomic sequence of G. pulchrum (GenBank accession no. KM264298) was 13,798 bp in size (Figure 1). It contains 12 protein-coding genes (cox1-3, nad1-6, nad4L, atp6 and cytb), two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes and one non-coding (control or AT-rich) region, but lacks the atp8 gene (Table 2). The gene content and arrangement are the same as those of T. callipaeda (Thelaziidae) [15] and S. digitata (Onchocercidae) [32], but distinct from those of D. medinensis (Dracunculidae) and H. longissimum (Physalopteridae) [12]. All genes are transcribed in the same direction. In addition, the mt genome of G. pulchrum has 24 intergenic regions, ranging from 1 to 78 bp in length. The longest region (78 bp) is between tRNA-Pro and tRNA-Asp genes (Table 2). The nucleotide content of the entire mt genome sequence of G. pulchrum is biased toward A+T (75.94%), in accordance with mt genomes of other spirurid nematodes (Table 3). AT- and GC-skews of the whole mt genome were calculated for G. pulchrum and other spirurid nematodes studied to date (Table 4). The composition of the mt genome sequence of G. pulchrum was strongly skewed towards T (AT skew = −0.413), and G (GC skew was 0.448) (Table 3).
Table 2

Mitochondrial genome organization of Gongylonema pulchrum

Gene/Region

Positions

Size (bp)

Number of aa a

Ini/Ter codons

In

cox1

1-1653

1653

550

ATG/TAA

+1

tRNA-Trp (W)

1659-1717

59

  

+5

nad6

1744-2175

432

143

ATT/TAA

+26

tRNA-Arg (R)

2194-2245

52

  

+18

tRNA-Gln (Q)

2246-2299

54

  

0

cytb

2323-3386

1064

354

ATT/TA

+23

tRNA-LeuCUN (L1)

3387-3442

56

  

0

cox3

3449-4222

774

257

TTG/TAA

+6

Non-coding region

4223-4656

434

  

0

tRNA-Ala (A)

4657-4713

57

  

0

tRNA-LeuUUR (L2)

4715-4768

54

  

+1

tRNA-Asn (N)

4770-4828

59

  

+1

tRNA-Met (M)

4839-4895

57

  

+10

tRNA-Lys (K)

4902-4959

58

  

+6

nad4L

4968-5195

228

75

TTG/TAA

+8

rrnS

5196-5876

681

  

0

tRNA-Tyr (Y)

5877-5933

57

  

0

nad1

5940-6804

865

288

TTG/T

+6

tRNA-Phe (F)

6807-6863

57

  

+2

atp6

6866-7442

577

192

GTT/T

+2

tRNA-Ile (I)

7443-7498

56

  

0

tRNA-Gly (G)

7506-7561

56

  

+7

cox2

7565-8255

691

230

ATG/T

+3

tRNA-His (H)

8256-8315

60

  

0

rrnL

8316-9280

965

  

0

nad3

9281-9620

340

113

GTG/T

0

tRNA-Cys (C)

9622-9676

55

  

+1

tRNA-SerUCN (S2)

9677-9730

54

  

0

tRNA-Pro (P)

9731-9784

54

  

0

tRNA-Asp (D)

9863-9917

55

  

+78

tRNA-Val (V)

9921-9973

53

  

+3

nad5

9979-11560

1582

527

TTG/T

+5

tRNA-Glu (E)

11562-11618

57

  

+1

tRNA-SerAGN (S1)

11620-11671

52

  

+1

nad2

11684-12513

830

276

ATG/TA

+12

tRNA-Thr (T)

12514-12568

55

  

0

nad4

12574-13797

1224

407

GTT/TAG

+5

aThe inferred length of amino acid sequence of 12 protein-coding genes; Ini/Ter codons: initiation and termination codons; In: Intergenic nucleotides.

Table 3

Comparison of A+T content (%) of gene and region of the mt genomes of spirurid nematodes sequenced to date (alphabetical order), including Gongylonema pulchrum (in bold)

Gene/region

AV

BM

CQ

DI

DM

GP

HL

LL

OF

OV

SD

SL

TC

WB

atp6

75.21

75.09

80.14

71.88

72.40

78.73

77.89

76.46

73.71

72.99

74.23

74.87

74.23

76.63

cox1

67.36

68.98

70.28

67.88

68.21

68.6

71.69

69.48

69.70

67.03

69.10

66.97

67.88

67.70

cox2

66.81

68.96

73.25

69.15

68.25

71.64

74.71

71.53

68.10

69.24

69.38

68.51

67.38

70.57

cox3

71.54

72.69

76.92

71.79

71.54

73.0

75.93

76.20

72.18

71.79

72.56

71.39

72.41

74.33

cytb

72.32

73.97

76.13

72.25

72.14

74.72

79.30

75.35

73.65

72.11

72.34

72.85

73.68

72.70

nad1

73.43

73.55

75.85

72.94

72.29

72.95

75.69

72.85

71.60

69.78

72.78

72.50

73.22

72.52

nad2

74.68

77.61

82.39

74.39

76.93

77.86

82.92

77.26

75.56

74.30

76.49

70.91

77.35

75.71

nad3

79.82

79.35

81.71

77.15

75.89

82.94

83.18

79.82

76.56

76.11

77.06

80.65

80.24

84.27

nad4

73.98

76.31

78.05

74.55

72.32

76.23

80.36

75.75

74.05

73.15

76.91

74.47

75.59

73.88

nad4L

76.89

82.08

83.33

77.37

74.39

77.63

82.05

81.09

77.73

78.60

76.76

76.75

80.17

80.66

nad5

71.93

74.81

78.17

73.75

73.64

74.97

78.93

74.03

73.62

72.87

74.81

72.88

73.82

74.69

nad6

77.19

81.46

82.89

80.57

76.26

81.02

81.74

81.98

81.11

79.11

82.44

77.56

80.17

80.04

rrnS

75.48

76.04

76.85

75.84

73.59

78.56

80.50

76.56

75.84

74.71

74.55

76.09

75.68

75.30

rrnL

77.78

80.78

80.25

79.55

76.70

81.14

81.81

78.65

77.71

76.95

79.40

79.05

77.43

79.01

AT-loop

83.37

85.11

86.49

85.91

74.75

81.11

96.75

83.68

79.93

85.32

86.36

88.50

79.57

83.71

Entire

73.54

75.46

77.67

74.16

72.72

76.0

79.11

75.54

74.17

73.30

75.14

73.73

74.57

74.59

Nematodes: AV: Acanthocheilonema viteae, BM: Brugia malayi, CQ: Chandlerella quiscali, DI: Dirofilaria immitis, DM: Dracunculus medinensis, GP: Gongylonema pulchrum, HL: Heliconema longissimum, LL: Loa loa, OF: Onchocerca flexuosa, OV: Onchocerca volvulus, SD: Setaria digitata, SL: Spirocerca lupi, TC: Thelazia callipaeda, WB: Wuchereria bancrofti, Entire: entire mt genome.

Table 4

Nucleotide composition of the mt genomes of spirurid nematodes, including that of Gongylonema pulchrum (in bold)

Species

Nucleotide frequency (%)

Whole genome sequence

A

T

G

C

A+T%

AT skew

GC skew

Acanthocheilonema viteae

19.56

53.98

19.26

7.20

73.54

−0.468

0.456

Brugia malayi

21.60

53.86

16.82

7.72

75.46

−0.428

0.371

Chandlerella quiscali

23.02

54.65

15.92

6.41

77.67

−0.407

0.426

Dirofilaria immitis

19.26

54.90

19.28

6.56

74.16

−0.481

0.492

Dracunculus medinensis

20.12

52.60

20.75

6.53

72.72

−0.447

0.521

Gongylonema pulchrum

22.27

53.67

17.42

6.64

75.94

0.413

0.448

Heliconema longissimum

26.22

.89

14.14

6.75

79.11

−0.337

0.354

Loa loa

20.78

54.76

17.73

6.73

75.54

−0.450

0.450

Onchocerca flexuosa

20.30

53.88

18.60

7.23

74.17

−0.430

0.440

Onchocerca volvulus

19.26

54.04

19.84

6.86

73.30

−0.474

0.486

Setaria digitata

19.42

55.71

18.14

6.72

75.14

−0.483

0.459

Spirocerca lupi

21.9

51.83

19.4

6.87

73.73

−0.406

0.477

Thelazia callipaeda

22.39

52.18

18.42

7.01

74.57

−0.40

0.449

Wuchereria bancrofti

20.14

54.45

18.20

7.21

74.59

−0.460

0.433

The most common initiation codon for G. pulchrum is TGG, followed by ATG, ATT, GTT and GTG (4, 3, 2, 2, 1 genes, respectively; Table 2). The most frequent complete termination codon is TAA (4 genes); nad4 is terminated with the codon TAG. Of the remaining genes, nad1, nad3, nad5, atp6 and cox2 are terminated with the abbreviated stop codon T, whereas cytb and nad2 are terminated with the abbreviated stop codon TA. This is consistent with the arrangement in the mt genomes of other nematodes [27,33-35].

Twenty-two tRNA genes were predicted from the mt genome of G. pulchrum and varied from 52 to 59 bp in length. Twenty of the 22 tRNA genes (excluding two tRNA-Ser) have a predicted secondary structure with a 3–5 bp DHU arm and a DHU loop of 7–9 bases, in which the variable TψC arm and loop are replaced by a “TV-replacement loop” of 8–10 bases. As seen in almost all other nematode mtDNAs [36], the tRNA-Ser gene of G. pulchrum mt genome is equipped with a TψC arm and loop but lacks the DHU arm and loop, consisting of a 6–8 bp TψC arm, TψC loop of 4–6 bases and a variable loop of 4 bases. The majority of nematode mtDNA sequences usually contain two non-coding regions with significant size difference [37], but there is only one non-coding region (AT-rich region) in the mt genome of G. pulchrum which is located between cox3 and tRNA-Ala (Figure 1 and Table 2), with 81.11% of A+T content (Table 3). Furthermore, this region is devoid of consecutive sequences of [A] and [T], and there are no AT dinucleotide repeat sequences; these repeat regions have been reported in the mt genome of A. simplex s.l. and S. digitata [32,34].

Identification and differentiation of G. pulchrum has traditionally been based on morphological features. However, these criteria are often insufficient for specific identification and differentiation, particularly at the larval and/or egg stages. Molecular tools, using genetic markers in mt cox1 and ITS-1 region of nuclear rDNA, have been used to support clinical diagnosis and to assist in undertaking molecular identification and epidemiological investigations of G. pulchrum [8]. Because sequence polymorphism (heterogeneity) in ITS rDNA sequences occurs within individual spirurid specimens [38], mt genome sequences appear to be better solutions for such studies. Additionally, the cox1 sequences of G. pulchrum were further divided into multiple haplotypes and two groups of haplotypes (i.e. those from a majority of sika deer, wild boars and Japanese macaques and those from cattle and zoo animals, were clearly differentiated) [8]. Nonetheless, the cox1 is a relatively conserved mt gene in nematodes [13,16,39], and, to date, there is no genetic information for G. pulchrum from other mt genes.

Phylogenetic analyses of G. pulchrum with related nematodes of the infraorder Spiruromorpha were performed by BI based on concatenated mitochondrial amino acid sequences of 12 protein-coding genes (Figure 2). Gongylonema pulchrum (Gongylonematidae) formed the sister group to Spirocerca lupi. Together they formed the sister group to a clade composed of Setariidae and Onchocercidae. Thelazia callipaeda (Thelaziidae) took an early diverging position to the above mentioned taxa, whereas Heliconema longissimum (Physalopteridae) and Toxascaris leonina took an unresolved position at the root of the tree (Figure 2).
Figure 2
Figure 2

Phylogenetic relationships of Gongylonema pulchrum with representative members of the infraorder Spiruromorpha based on mitochondrial sequence data. The concatenated amino acid sequences of 12 protein-coding genes were analyzed using Bayesian inference (BI) using Toxascaris leonina as the outgroup. Bayesian posterior probability (Bpp) values are indicated.

Many studies have indicated that the mtDNA sequence is a valuable genetic marker for phylogenetic studies [11,12,14,17]. The mt genome sequence of G. pulchrum could promote to reassess the systematic relationships within the spirurid nematodes using mt genomic datasets. Over the last decades, there have been considerable debate concerning the systematics of members of the spirurid nematodes (including superfamilies Filarioidea, Physalopteroidea, Spiruroidea and Thelazoidea) [40]. Some studies using nuclear small subunit (SSU) rDNA and mtDNA sequences have indicated that S. lupi (Spirocercidae) is the sister taxon of T. callipaeda (Thelaziidae), suggesting that S. lupi belongs to the superfamily Thelazioidea [41,42], but this finding was contradicted by other studies that used the same markers [43,44]. The results of the present study support that the Spirocercidae (represented by S. lupi) was more closely related to the family Gongylonematidae (represented by G. pulchrum) than to other families within Spiruromorpha, indicating that both families Spirocercidae and Gongylonematidae belong to superfamily Spiruroidea, consistent with conclusions of a previous study [40]. Given this utility of mt genomic datasets, further work should include sequencing of mt genomes of other spirurid nematodes in order to reconstruct the phylogenetic relationships of spirurid nematodes.

Conclusions

The present study determined the complete mt genome sequence of G. pulchrum, and ascertained its phylogenetic position within the infraorder Spiruromorpha. The complete mt genome represents the first sequenced mt genome of any member of the family Gongylonematidae. It will provide an important resource for the design of novel primers for the study of epidemiology, population genetics and systematics of Gongylonematidae.

Notes

Declarations

Acknowledgements

This work was supported, in part, by grants from Funds of Basic Research Key Program (ZD2012010) to GHZ, the International Science & Technology Cooperation Program of China (Grant No. 2013DFA31840) and the Science Fund for Creative Research Groups of Gansu Province (Grant No. 1210RJIA006) to XQZ.

Authors’ Affiliations

(1)
State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu Province, 730046, Peoples Republic of China
(2)
College of Veterinary Medicine, Northwest A&F University, Shaanxi Province, Yangling, 712100, Peoples Republic of China

References

  1. Cappucci Jr DT, Augsburg JK, Klinck PC. Gongylonemiasis. In: Steele JH, editor. Handbook Series in Zoonoses, Section C: Parasitic Zoonoses, vol. II. Boca Raton, Florida: CRC Press; 1982. p. 181–92.Google Scholar
  2. Anderson RC: Nematode parasites of vertebrates; their development and transmission. C.A.B. International, Oxon, 1992.Google Scholar
  3. Kudo N, Kubota H, Gotoh H, Ishida H, Ikadai H, Oyamada T. Efficacy of thiabendazole, mebendazole, levamisole and ivermectin against gullet worm, Gongylonema pulchrum: In vitro and in vivo studies. Vet Parasitol. 2008;151:46–52.View ArticlePubMedGoogle Scholar
  4. Zhang ZW, Zhang HF, Gao CY. The endoscopic diagnosis and treatment of esophageal gongylonemiasis. Chin Foreign Med Treat. 2011;6:31 (in Chinese).Google Scholar
  5. Battistelli-Lux C. Buccal infection with Gongylonema pulchrum: an indigenous case in France. Ann Dermatol Venereol. 2013;140:623–7 (In France).View ArticlePubMedGoogle Scholar
  6. Pesson B, Hersant C, Biehler JF, Abou-Bacar A, Brunet J, Pfaff AW, et al. First case of human gongylonemosis in France. Parasite. 2013;20:5.View ArticlePubMed CentralPubMedGoogle Scholar
  7. Allen JD, Esquela-Kerscher A. Gongylonema pulchrum Infection in a Resident of Williamsburg, Virginia, Verified by Genetic Analysis. Am J Trop Med Hyg. 2013;89:755–7.View ArticlePubMed CentralPubMedGoogle Scholar
  8. Makouloutou P, Setsuda A, Yokoyama M, Tsuji T, Saita E, Torii H, et al. Genetic variation of Gongylonema pulchrum from wild animals and cattle in Japan based on ribosomal RNA and mitochondrial cytochrome c oxidase subunit I genes. J Helminthol. 2013;87:326–35.View ArticlePubMedGoogle Scholar
  9. Wolstenholme DR. Animal mitochondrial DNA, structure and evolution. Int Rev Cytol. 1992;141:173–216.View ArticlePubMedGoogle Scholar
  10. Boore JL. Animal mitochondrial genomes. Nucleic Acids Res. 1999;27:1767–80.View ArticlePubMed CentralPubMedGoogle Scholar
  11. Kang S, Sultana T, Eom KS, Park YC, Soonthornpong N, Nadler SA, et al. The mitochondrial genome sequence of Enterobius vermicularis (Nematoda: Oxyurida)–an idiosyncratic gene order and phylogenetic information for chromadorean nematodes. Gene. 2009;429:87–97.View ArticlePubMedGoogle Scholar
  12. Park JK, Sultana T, Lee SH, Kang S, Kim HK, Min GS, et al. Monophyly of clade III nematodes is not supported by phylogenetic analysis of complete mitochondrial genome sequences. BMC Genomics. 2011;12:392.View ArticlePubMed CentralPubMedGoogle Scholar
  13. Liu GH, Gasser RB, Su A, Nejsum P, Peng L, Lin RQ, et al. Clear genetic distinctiveness between human- and pig-derived Trichuris based on analyses of mitochondrial datasets. PLoS Negl Trop Dis. 2012;6:e1539.View ArticlePubMed CentralPubMedGoogle Scholar
  14. Liu GH, Shao R, Li JY, Zhou DH, Li H, Zhu XQ. The complete mitochondrial genomes of three parasitic nematodes of birds: a unique gene order and insights into nematode phylogeny. BMC Genomics. 2013;14:414.View ArticlePubMed CentralPubMedGoogle Scholar
  15. Liu GH, Gasser RB, Otranto D, Xu MJ, Shen JL, Mohandas N, et al. Mitochondrial genome of the eyeworm, Thelazia callipaeda (nematoda: spirurida), as the first representative from the family Thelaziidae. PLoS Negl Trop Dis. 2013;7:e2029.View ArticlePubMed CentralPubMedGoogle Scholar
  16. Liu GH, Zhao L, Song HQ, Zhao GH, Cai JZ, Zhao Q, et al. Chabertia erschowi (Nematoda) is a distinct species based on nuclear ribosomal DNA sequences and mitochondrial DNA sequences. Parasit Vectors. 2014;7:44.View ArticlePubMed CentralPubMedGoogle Scholar
  17. Sultana T, Kim J, Lee SH, Han H, Kim S, Min GS, et al. Comparative analysis of complete mitochondrial genome sequences confirms independent origins of plant-parasitic nematodes. BMC Evol Biol. 2013;13:12.View ArticlePubMed CentralPubMedGoogle Scholar
  18. Zhao GH, Hu B, Cheng WY, Jia YQ, Li HM, Yu SK, et al. The complete mitochondrial genomes of Oesophagostomum asperum and Oesophagostomum columbianum in small ruminants. Infect Genet Evol. 2013;19:205–11.View ArticlePubMedGoogle Scholar
  19. Gao JF, Zhao Q, Liu GH, Zhang Y, Zhang Y, Wang WT, et al. Comparative analyses of the complete mitochondrial genomes of the two ruminant hookworms Bunostomum trigonocephalum and Bunostomum phlebotomum. Gene. 2014;541:92–100.View ArticlePubMedGoogle Scholar
  20. Sato H, Une Y, Takada M. High incidence of the gullet worm, Gongylonema pulchrum, in a squirrel monkey colony in a zoological garden in Japan. Vet Parasitol. 2005;127:131–7.View ArticlePubMedGoogle Scholar
  21. Hu M, Jex AR, Campbell BE, Gasser RB. Long PCR amplification of the entire mitochondrial genome from individual helminths for direct sequencing. Nature Protoc. 2007;2:2339–44.View ArticleGoogle Scholar
  22. Liu GH, Wang Y, Song HQ, Li MW, Ai L, Yu XL, et al. Characterization of the complete mitochondrial genome of Spirocerca lupi: sequence, gene organization and phylogenetic implications. Parasit Vectors. 2013;6:45.View ArticlePubMed CentralPubMedGoogle Scholar
  23. Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30:772–80.View ArticlePubMed CentralPubMedGoogle Scholar
  24. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA 5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28:2731–9.View ArticlePubMed CentralPubMedGoogle Scholar
  25. Lowe TM, Eddy SR. tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997;25:955–64.View ArticlePubMed CentralPubMedGoogle Scholar
  26. Hu M, Chilton NB, Gasser RB. The mitochondrial genomes of the human hookworms, Ancylostoma duodenale and Necator americanus (Nematoda: Secernentea). Int J Parasitol. 2002;32:145–58.View ArticlePubMedGoogle Scholar
  27. Liu GH, Zhou DH, Zhao L, Xiong RC, Liang JY, Zhu XQ. The complete mitochondrial genome of Toxascaris leonina: comparison with other closely related species and phylogenetic implications. Infect Genet Evol. 2014;21:329–33.View ArticlePubMedGoogle Scholar
  28. Talavera G, Castresana J. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst Biol. 2007;56:564–77.View ArticlePubMedGoogle Scholar
  29. Abascal F, Zardoya R, Posada D. ProtTest: selection of best-fit models of protein evolution. Bioinformatics. 2005;21:2104–5.View ArticlePubMedGoogle Scholar
  30. Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19:1572–4.View ArticlePubMedGoogle Scholar
  31. Rambaut A: FigTree, a graphical viewer of phylogenetic trees. 2012. Available from http://tree.bio.ed.ac.uk/software/figtree.
  32. Yatawara L, Wickramasinghe S, Rajapakse RP, Agatsuma T. The complete mitochondrial genome of Setaria digitata (Nematoda: Filarioidea): Mitochondrial gene content, arrangement and composition compared with other nematodes. Mol Biochem Parasitol. 2010;173:32–8.View ArticlePubMedGoogle Scholar
  33. Li MW, Lin RQ, Song HQ, Wu XY, Zhu XQ. The complete mitochondrial genomes for three Toxocara species of human and animal health significance. BMC Genomics. 2008;9:224.View ArticlePubMed CentralPubMedGoogle Scholar
  34. Kim KH, Eom KS, Park JK. The complete mitochondrial genome of Anisakis simplex (Ascaridida: Nematoda) and phylogenetic implications. Int J Parasitol. 2006;36:319–28.View ArticlePubMedGoogle Scholar
  35. Okimoto R, Macfarlane JL, Clary DO, Wolstenholme DR. The mitochondrial genomes of two nematodes, Caenorhabditis elegans and Ascaris suum. Genetics. 1992;130:471–98.PubMed CentralPubMedGoogle Scholar
  36. Jex AR, Hall RS, Littlewood DT, Gasser RB. An integrated pipeline for next-generation sequencing and annotation of mitochondrial genomes. Nucleic Acids Res. 2010;38:522–33.View ArticlePubMed CentralPubMedGoogle Scholar
  37. Hu M, Gasser RB. Mitochondrial genomes of parasitic nematodes–progress and perspectives. Trends Parasitol. 2006;22:78–84.View ArticlePubMedGoogle Scholar
  38. Gasser RB, LeGoff L, Petit G, Bain O. Rapid delineation of closely-related filarial parasites using genetic markers in spacer rDNA. Acta Trop. 1996;62:143–50.View ArticlePubMedGoogle Scholar
  39. Liu GH, Gasser RB, Nejsum P, Wang Y, Chen Q, Song HQ, et al. Mitochondrial and nuclear ribosomal DNA evidence supports the existence of a new Trichuris species in the endangered françois’ leaf-monkey. PLoS One. 2013;8:e66249.View ArticlePubMed CentralPubMedGoogle Scholar
  40. De Ley P, Blaxter M. Systematic position and phylogeny. In: Lee DL, editor. The Biology of Nematodes. London and New York.: Taylor & Francis; 2002. p. 1–30.View ArticleGoogle Scholar
  41. Iorio R, Slapeta J, Otranto D, Paoletti B, Giangaspero A, Traversa D. Phylogenetic relationships of Habronema microstoma and Habronema muscae (Spirurida: Habronematidae) within the order Spirurida inferred using mitochondrial cytochrome c oxidase subunit 1 (cox1) gene analysis. Parasitol Res. 2009;104:979–84.View ArticlePubMedGoogle Scholar
  42. Černotíková E, Horák A, Moravec F. Phylogenetic relationships of some spirurine nematodes (Nematoda: Chromadorea: Rhabditida: Spirurina) parasitic in fishes inferred from SSU rRNA gene sequences. Folia Parasitol. 2011;58:135–48.View ArticlePubMedGoogle Scholar
  43. Traversa D, Costanzo F, Iorio R, Aroch I, Lavy E. Mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequence of Spirocerca lupi (Nematoda, Spirurida): avenues for potential implications. Vet Parasitol. 2007;146:263–70.View ArticlePubMedGoogle Scholar
  44. Nadler SA, Carreno RA, Mejía-Madrid H, Ullberg J, Pagan C, Houston R, et al. Molecular phylogeny of clade III nematodes reveals multiple origins of tissue parasitism. Parasitology. 2007;134:1421–42.View ArticlePubMedGoogle Scholar

Copyright

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate. Please note that comments may be removed without notice if they are flagged by another user or do not comply with our community guidelines.

Advertisement