Open Access

Analysis of the complete Fischoederius elongatus (Paramphistomidae, Trematoda) mitochondrial genome

  • Xin Yang1,
  • Yunyang Zhao1,
  • Lixia Wang2,
  • Hanli Feng3,
  • Li Tan1,
  • Weiqiang Lei1,
  • Pengfei Zhao1,
  • Min Hu1 and
  • Rui Fang1Email author
Contributed equally
Parasites & Vectors20158:279

https://doi.org/10.1186/s13071-015-0893-3

Received: 17 March 2015

Accepted: 9 May 2015

Published: 20 May 2015

Abstract

Background

Fischoederius elongates is an important trematode of Paramphistomes in ruminants. Animals infected with F. elongates often don’t show obvious symptoms, so it is easy to be ignored. However it can cause severe economic losses to the breeding industry. Knowledge of the mitochondrial genome of F. elongates can be used for phylogenetic and epidemiological studies.

Findings

The complete mt genome sequence of F. elongates is 14,120 bp in length and contains 12 protein-coding genes, 22 tRNA genes, two rRNA genes and two non-coding regions (LNR and SNR). The gene arrangement of F. elongates is the same as other trematodes, such as Fasciola hepatica and Paramphistomum cervi. Phylogenetic analyses using concatenated amino acid sequences of the 12 protein-coding genes by Maximum-likelihood and Neighbor-joining analysis method showed that F. elongates was closely related to P. cervi.

Conclusion

The complete mt genome sequence of F. elongates should provide information for phylogenetic and epidemiological studies for F. elongates and the family Paramphistomidae.

Keywords

Fischoederius elongates Mitochondrial genome

Findings

Background

Paramphistomes are distributed worldwide and have been reported in many countries, such as Bulgaria, France, Poland, Hungary, Italy, India, Russia, Sardinia and Yugoslavia [1]. The paramphistome can infect fishes, reptiles, birds and mammals, some of which can lead to huge economic losses related to seriously gastrointestinal diseases, low producitivity or death in ruminants [2]. In Arumeru District, the prevalence rate of paramphistomes is as high as 56.7 % in cattle [3].

Fischoederius elongates is an important member of paramphistomes, the parasite usually inhabits the rumen of cattle, buffaloes, sheep and goats. Ruminants are usually infected by ingesting snails, such as Lymnaea acuminata, Lymnaea succinea or Gyraulus euphraticus [4]. Ruminants infected with F. elongates show weakness, mental fatigue and eventually death. More seriously, F. elongates maybe a zoonotic trematode, a Chinese woman from Guangdong Province was reported to be the first human infection case [5], but it is still unknown how she was infected.

Untill now, the most common diagnostic method for F. elongates is the microscopical examination, but it’s time-consuming, and hard to distinguish with other paramphistomes. As a useful marker, mt genome has been widely used for species identification [610]. The complete mt genome of F. elongates can provide alternative molecular markers for the species identification, epidemiology and genetic diversity of paramphistomes.

In the present study, we got the full sequence and gene arrangement of mt genome of F. elongates and compared it with selected trematodes. We found that F. elongates had the closest relationship with P. cervi.

Methods

Ethical approval

The study was performed under the instructions and approval of Laboratory Animals Research Centre of Hubei province in P. R. China and the ethics committee of Huazhong Agricultural University (Permit number: 4200695757).

Parasite collection and DNA isolation

F. elongates adults were collected from the rumen and reticulum of naturally infected cattle in Zhanggang, Tianmen, Hubei province, PR China, according to the Animal Ethics Guidelines of Huazhong Agricultural University. Then, the adult worms were washed extensively in 0.9 % sodium chloride solution, and identified through morphological examinations [2]. Subsequently, one worm was stained for identification [11], and the rest were fixed in 75 % alcohol (V/V) and stored at −20 °C until use [12]. Total genomic DNA was isolated from one worm [13]. The ITS-2 region of F. elongates was amplified and sequenced as reported previously [14], it was 100 % similar to that of F. elongates (GenBank accession no. JQ688410.1).

Amplification and sequencing of F. elongates mt genome

Firstly, we designed 12 oligonucleotide primers according to the conserved regions from reported mt genome sequences of F. hepatica [15], Clonorchis sinensis [16] and P. cervi [17] to amplify partial fragments from cox3, cytb, nad4, cox1, rrnS and nad5 (Table 1). PCRs (25 μl) were performed in the following reaction: 10 mM Tris–HCl (pH 8.4), 50 mM KCl, 4 mM MgCl2, 200 mM each of dNTP, 50 pmol of each primer,2 U Taq polymerase (Takara) and 2.5 μl genomic DNA. Reactions were run under the following conditions: 94 °C for 5 min, followed by 35 cycles of 94 °C/30 s, 50 °C/30 s and 72 °C/1 min. Amplicons were sent to Sangon Company (Shanghai, China) for sequencing.
Table 1

Primers used in the present study

Primer codes

Sequences (5′-3′)

Target gene

References

XCCOX3F

AGYACDGTDGGDTTRCATTT

cox31

Present study

XCCOX3R

CANAYATAATCMACARAATGNCA

cox31

Present study

nxccobF

ATGTCWTWTTGRGCKGCBACNGT

cytb1

Present study

nxccobR

GADVCTCNGGRTGRCAVGCHCC

cytb1

Present study

nxcND4F

GAKTCBCCDTATTCDGARCG

nad41

Present study

nxcND4R

ACHCCNGCHGANANMCCRTGMCC

nad41

Present study

TXCCOX1F

GGHTGAACHRTWTAYCCHCC

cox11

Present study

TXCCOX1R

TGRTGRGCYCAWACDAYAMAHCC

cox11

Present study

XC12SF

AAWAAYGAGAGYGACGGGCG

rrnS1

Present study

XC12SR

TARACTAGGATTAGATACCC

rrnS1

Present study

NxcND5F

TGKTTGCBTCNCGNTTBGGNGATG

nad51

Present study

NxcND5R

TAACACTTRCANAHMCCRTGHGT

nad51

Present study

3CF1

TGCATGTAGTGATAGGTTTGG

cox3- cytb2

Present study

3CR1

AACTAACGTAACATTTGTCAC

cox3- cytb2

Present study

3CF2

TTTGTTTTGTGGTTGCCTTC

cytb-nad42

Present study

3CR2

AACGTAAATTAAACCTCCCCC

cytb-nad42

Present study

3CF3

TGGCGTTTTTGAGTTTGTCTC

nad4-cox12

Present study

3CR3

TCAACGAACTCAATATACTTG

nad4-cox12

Present study

3CF4

TGGTTTCGGGGCTGTGAGAC

cox1-rrnS2

Present study

3CR4

ACCAAGCAAAGAAAATTCTACC

cox1-rrnS2

Present study

3CF5

TGTTAAAAGGCTTTGGTGTG

rrnS-nad52

Present study

3CR5-1

ACCAACCAAACCTACACATC

rrnS-nad52

Present study

3CF6-1

TTACGTTAGTTGGGTTGTTG

nad5-cox32

Present study

3CR6

TTACATCTTTATAAAACACTTTC

nad5-cox32

Present study

1 short regions amplified by PCR from cox3 (139 bp), cytb (613 bp), nad4 (554 bp), cox1 (497 bp), rrnS (500 bp) and nad5(458 bp). 2 large fragments that were amplified by long-range PCR from cox3-cytb (724 bp), cytb-nad4 (1008 bp), nad4-cox1 (4675 bp), cox1-rrnS (2198 bp), rrnS-nad5 (1981 bp) and nad5-cox3 (1718 bp)

Then, 12 additional primers (Table 1) were designed based on the obtained sequencing results to amplify six regions from genomic DNA (~40-80 ng) by long-PCR. PCRs (50 μl) were performed in reactions containing 0.4 mM each of dNTPs, 5 μl 10× LA Taq buffer II(Mg2+ Plus), 2.5 μM of each primer, 2.5 U LA Taq polymerase (Takara) and 2.5 μl genomic DNA. And the reactions were run under the following program: 94 °C for 5 min, followed by 35 cycles of 94 °C/30 s, 50 °C/30 s and 72 °C/1-5 min (depending on the size of F. hepatica). Amplicons were cloned into pGEM-T-Easy vector (Promega, USA) and then sequenced using a primer-walking strategy [18].

Sequence analyses

F. elongates mt genome sequences were assembled manually and then aligned with the mt genome sequences of F. hepatica, C. sinensis and P. cervi using the program Clustal X 1.83 [19]. Open reading frames were identified by ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) using the echinoderm and flatworm mitochondrial code. Initiation and termination codons of the 12 protein-coding genes were identified as reported [15]. The 22 tRNA genes were predicted using tRNAscan-SE or manual adjustments [20,21]. The two rRNA genes were predicted by comparison with those of F. hepatica [15], C. sinensis [16] and P. cervi [17]. Amino acid sequences of 12 protein-coding genes were inferred using ExPASy Translate tool (http://web.expasy.org/translate/) using the echinoderm and flatworm mitochondrial codes, and aligned using MEGA 5.0 with default settings [22].

Nucleotide variation analysis

The nucleotide variation between F. elongates and P. cervi was analysed by sliding window analysis as reported [17].

Phylogenetic analysis

Amino acid sequences translated from individual genes of the mt genome of F. elongates were aligned with those predicted from mt genomes of selected trematodes, including C. sinensis (NC_012147) [16], Dicrocoelium dendriticum (NC_025280.1) [23], F. hepatica (NC_002546) [15], Haplorchis taichui (NC_022433.1) [24], Metagonimus yokogawai (KC330755.1), Opisthorchis viverrini (JF739555.1) [25], P. cervi (NC_023095.1) [17], Schistosoma haematobium (NC_008074) [26], Schistosoma japonicum (AF215860) [15], Schistosoma mekongi (NC_002529) [27], Schistosoma spindale (NC_008067) [26], and the cestode Taenia solium (outgroup) (NC_004022.1) [28]. The amino acid sequences of selected trematodes were aligned using MEGA 5.0 [22], and phylogenetic analysis of the aligned amino acid sequences was conducted in MEGA 5.0 using the Maximum Likelihood (ML) method.

Results and discussion

Features of the mt genome of F. elongates

The complete mitochondrial genome of F. elongates (GenBank accession no. KM_397348) is 14,120 bp in length. The length of the F. elongates mt genome is larger than the mtDNA genomes of C. sinensis (13,875 bp) and S. japonicum (14,085 bp), but smaller than D. dendriticum (14,884 bp), F. hepatica (14,462 bp), H. taichui (15,130 bp), M. yokogawai (15,258 bp), S. haematobium (15,003 bp), S. mekongi (14,072 bp) and S. spindale (16,901 bp).

The circular mt genome of F. elongates includes 12 protein-coding genes (cox1-3, nad1-6, nad4L, cytb and atp6), 22 tRNA genes, two rRNA genes (rrnS and rrnL) and two non-coding regions (SNR and LNR). All the 12 protein-coding genes are transcribed in the same direction (Fig. 1), which is the same as in F. hepatica [15], C. sinensis [16] and P. cervi [17]. The gene arrangement order is as follow: cox3-cytb-nad4L-nad4-atp6-nad2-nad1-nad3-cox1-rrnL-rrnS-cox2-nad6-nad5, which is consistent with F. hepatica, O. viverrini, P. cervi, S. japonicum and S. mekongi, except for S. haematobium and S. spindale [26].
Fig. 1

Arrangement of the mitochondrial genome of Fischoederius elongatus

Overlapping nucleotides between mt genes of F. elongates ranged from 1 to 53 bp (Table 2). The F. elongates mt genome has 26 intergenic spacers ranging from 1 bp to 148 bp in length (Table 2). The nucleotide contents of A, C, T and G in the mt genome are 19.78 %, 9.62 %, 44.10 % and 26.50 %, respectively (Table 3), with T being the most favored nucleotide, followed by G, A and C, which is also the same as the mt genomes of F. hepatica [15], C. sinensis [16] and P. cervi [17]. The A + T content of 12 protein coding genes and 22 rRNA genes of F. elongates ranged from 59.65 % (rrnS) to 66.97 % (cox3), and the overall A + T content of the mt genome is 63.88 %.
Table 2

The organization of the mitochondrial genome of Fischoederius elongatus

Gene/region

Positions

Size (bp)

Number of aa1

Ini/Ter codons2

Anticodons

In3

cox3

1-645

645

215

ATG/TAG

 

0

trnH

648-715

68

  

GTG

+2

cytb

717-1829

1113

371

ATG/TAA

 

+1

SNR

1830-1892

63

   

0

nad4L

1893-2156

264

88

ATG/TAG

 

0

nad4

2117-3397

1281

427

GTG/TAA

 

−38

trnQ

3409-3471

63

  

TTG

+11

trnF

3486-3549

65

  

GAA

+14

trnM

3549-3612

64

  

CAT

−1

atp6

3613-4128

516

172

ATG/TAG

 

0

nad2

4133-5008

876

292

GTG/TAG

 

+4

trnV

5039-5102

64

  

TAC

+30

trnA

5109-5179

71

  

TGC

+6

trnD

5328-5397

70

  

GTC

+148

nad1

5400-6296

897

299

ATG/TAG

 

+2

trnN

6314-6379

66

  

GTT

+17

trnP

6384-6447

64

  

TGG

+4

trnI

6449-6511

63

  

GAT

+1

trnK

6518-6582

65

  

CTT

+6

nad3

6587-6943

357

119

ATG/TAG

 

+4

trnS1

6955-7014

60

  

GCT

+11

trnW

7027-7091

65

  

TCA

+12

cox1

7095-8636

1542

514

GTG/TAA

 

+3

trnT

8646-8709

64

  

TGT

+9

rrnL4

8710-9704

995

   

0

trnC

9707-9767

61

  

GCA

+2

rrnS4

9768-10518

751

   

0

cox2

10519-11100

582

194

ATG/TAG

 

0

nad6

11046-11546

501

167

ATG/TAG

 

−53

trnY

11568-11632

65

  

GTA

+21

trnL1

11652-11715

64

  

TAG

+19

trnS2

11717-11785

69

  

TGA

+1

trnL2

11792-11856

65

  

TAA

+6

trnR

11860-11925

66

  

TCG

+3

nad5

11926-13506

1581

527

GTG/TAG

 

0

trnG

13510-13574

65

  

TCC

+3

trnE

13587-13651

65

  

TTC

+12

LNR

13652-14120

469

   

0

The inferred length of amino acid sequence of 12 protein-coding genes: 1amino acid; 2initiation and termination codons; 3intergenic nucleotides; 4initiation or termination positions of ribosomal RNAs defined by adjacent gene boundaries

Table 3

Nucleotide contents of genes and the non-coding region within the mitochondrial genome of Fischoederius elongatus

Gene

A(%)

C(%)

G(%)

T(%)

A + T(%)

cox3

18.29

8.53

24.50

48.68

66.97

cytb

18.96

8.89

26.33

45.82

64.78

SNR

20.63

4.76

31.75

42.86

63.49

nad4L

21.97

8.33

25.38

44.32

66.29

nad4

16.55

9.52

25.45

48.48

65.03

atp6

17.64

10.08

24.42

47.87

65.50

nad2

15.64

7.99

25.11

51.26

66.89

nad1

16.39

7.47

28.21

47.94

64.33

nad3

15.97

7.84

28.01

48.18

64.15

cox1

18.87

11.02

24.51

45.59

64.46

rrnL

25.83

10.35

26.73

37.09

62.91

rrnS

24.37

12.25

28.10

35.29

59.65

cox2

19.93

11.11

27.49

41.58

61.51

nad6

17.44

8.61

26.71

47.24

64.68

nad5

16.32

8.29

28.78

46.62

62.93

LNR

26.01

9.17

26.44

38.38

64.39

The present F. elongates mt genome can provide useful information for the studies of epidemiology, species identification and genetic diversity of Fischoederius spp. At the same, it will also make contribution to the taxonomy study of Fischoederius spp. With the full mt genome of F. elongates, we can undertake a study within F. elongates from different regions or among Fischoederius spp. by combining the morphological features with genetic analyses (with molecular markers from mitochondria or ribosome, such as cox1, nad4, 18S, ITS-1 and ITS-2). Meanwhile, the mt genome of F. elongates may also provide information for the prevention and diagnosis of Fischoederius spp. and perhaps, this mt genome information may assist in the new drug, since mitochondria is the target of some drugs, such as decoquinate.

Protein-coding genes

The F. elongates mt genome has 12 protein-coding genes, including cox3, cytb, nad4L, nad4, atp6, nad2, nad1, nad3, cox1, cox2, nad6 and nad5. For these protein coding genes, ATG (eight of 12 protein genes) is the most common initiation codon, followed by GTG (four of 12 protein genes) (Table 2), which is the same as other trematodes, such as F. hepatica [15], C. sinensis [16], P. cervi [17], S. mekongi [27]. TAG (seven of 12 protein genes) or TAA (five of 12 protein genes) are the termination codons, this is in agreement with other digeneans, except for P. cervi (Only TAG was used as termination codons). Excluding the termination codons, 10,107 nucleotides encode 3,369 amino acids of protein-coding genes in the F. elongates mt genome. The most frequently used amino acid is TTT (Phe), with the frequency of 9.65 %, followed by TTT (Phe), TTG (Leu: 8.61 %), GTT (Val: 5.25 %) and TAT (Tyr: 5.02 %) (Table 4). The least used codons are AAC (Asn: 0.06 %), GAC (Asp: 0.06 %) and CGC (Arg: 0).
Table 4

Codon usage for 12 protein-coding genes in the mitochondrial genome of Fischoederius elongatus

Amino acid

Codon

Number

Frequency(%)

Amino acid

Codon

Number

Frequency(%)

Phe

TTT

325

9.65

Ile

ATT

127

3.77

Phe

TTC

28

0.83

Ile

ATC

6

0.18

Leu

TTA

167

4.96

Ile

ATA

71

2.11

Leu

TTG

290

8.61

Met

ATG

105

3.12

Ser

TCT

118

3.50

Met

GTG

165

4.90

Ser

TCC

6

0.18

Thr

ACT

54

1.60

Ser

TCA

22

0.65

Thr

ACC

3

0.09

Ser

TCG

25

0.74

Thr

ACA

19

0.56

Tyr

TAT

169

5.02

Thr

ACG

16

0.47

Tyr

TAC

11

0.33

Asn

AAT

54

1.60

Stop

TAA

3

0.09

Asn

AAC

2

0.06

Stop

TAG

9

0.27

Asn

AAA

23

0.68

Cys

TGT

112

3.32

Lys

AAG

50

1.48

Cys

TGC

9

0.27

Ser

AGT

92

2.73

Trp

TGA

41

1.22

Ser

AGC

9

0.27

Trp

TGG

72

2.14

Ser

AGA

31

0.92

Leu

CTT

43

1.28

Ser

AGG

35

1.04

Leu

CTC

3

0.09

Val

GTT

177

5.25

Leu

CTA

17

0.50

Val

GTC

12

0.36

Leu

CTG

23

0.68

Val

GTA

58

1.72

Pro

CCT

53

1.57

Ala

GCT

95

2.82

Pro

CCC

4

0.12

Ala

GCC

4

0.12

Pro

CCA

11

0.33

Ala

GCA

13

0.39

Pro

CCG

15

0.45

Ala

GCG

33

0.98

His

CAT

41

1.22

Asp

GAT

62

1.84

His

CAC

7

0.21

Asp

GAC

2

0.06

Gln

CAA

13

0.39

Glu

GAA

17

0.50

Gln

CAG

14

0.42

Glu

GAG

67

1.99

Arg

CGT

45

1.34

Gly

GGT

165

4.90

Arg

CGC

0

0

Gly

GGC

16

0.47

Arg

CGA

6

0.18

Gly

GGA

22

0.65

Arg

CGG

11

0.33

Gly

GGG

51

1.51

Transfer RNA and ribosomal RNA genes

The F. elongates mt genome encodes 22 tRNAs, and the length of 22 tRNA genes ranged from 60 bp to 71 bp (Table 2). There are two non-coding regions in F. elongates mt genome, rrnS (751 bp) and rrnL (995 bp) (Table 2). The location of rrnS is between tRNA-Cys and cox2 and the rrnL is between tRNA-Thr and tRNA-Cys, which is the same as other trematodes, such as F. hepatica [15], C. sinensis [16] and P. cervi [17].

Non-coding regions

Many flatworms have non-coding regions, it’s common to find two non-coding regions in trematodes: one long non-coding region (LNR) and one short non-coding region (SNR). In F. elongates, there is a short non-coding region (SNR: 62 nucleotides), which is located between cytb and nad4L. In addition, there is also a long non-coding region (LNR: 468 nucleotides) between tRNA-Phe and cox3 (Table 2), the LNR has two obvious features, one is microsatellite-like sequences, such as (TA)n (n <5); the other is homopolymer sequences, such as (T)n (n <7). People still don’t understand clearly why the non-coding regions exist, and the function of them, people just knew the non-coding regions may participate in the replication of mitochondria [26].

Nucleotide variability between F. elongates and P. cervi

A sliding window analysis of F. elongates and P. cervi using full mt genome sequences reflected the nucleotide diversity (π) for all the protein-coding genes (Fig. 2). The highest and lowest level of nucleotide variability was within nad6 and cox3, respectively. In our study, nad6 and cox2 are the most conserved genes, and cox3 and atp6 are the least conserved. With sliding window analysis, we could know the conserved regions of mt genome among species.
Fig. 2

A sliding window analysis of complete mt genome sequences of Fischoederius elongatus and Paramphistomum cervi. The black line showed nucleotide diversity in a window of 300 bp (10 bp steps). Nad4L and nad4, cox2 and nad6 are overlapping genes. Gene regions are marked in grey boxes and boundaries are indicated

Genetic relationships

Concatenated amino acid sequence data representing 12 protein-coding genes of 11 digenean species (C. sinensis, D. dendriticum, F. hepatica, H. taichui, M. yokogawai, O. viverrini, P. cervi, S. haematobium, S. japonicum, S. mekongi and S. spindale) and one tapeworm (T. solium) were used for genetic relationship analysis (Fig. 3). In the tree, we can find two large clades with strong support (100 %): one clade consists of eight members representing five families (Heterophyidae, Opisthorchiidae, Fasciolidae, Paramphistomidae and Dicrocoeliidae); the other clade is Schistosomatidae. In the present analysis, F. elongates has the closest genetic relationship with P. cervi (100 %), followed by Fasciolidae, this is consistent with their relationship in the classification of biology. At the same time, we also used NJ method analysis (not shown), and there was no difference between these two methods.
Fig. 3

The phylogenetic relationships of Fischoederius elongatus and other trematodes based on concatenated amino acid sequence data representing 12 protein-coding genes by Maximum Likelihood analysis, using Taenia solium as an outgroup

Notes

Declarations

Acknowledgements

Sincere thanks to Professor Bang Shen for comments on the manuscript. This work was supported in part by the “National Key Basic Research Program (973 Program) of China” (Grant No. 2015CB150300), the “Special Fund for Agro-scientific Research in the Public Interest” (Grant No. 201303037) and “Huazhong Agricultural University Students Research Fund” (Grant No. 2015054).

Authors’ Affiliations

(1)
State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University
(2)
Hubei Provincial Center for Diseases Control and Prevention
(3)
Hubei Entry-Exit Inspection and Quarantine Bureau

References

  1. Horak IG. Paramphistomiasis of domestic ruminants. Adv Parasitol. 1971;9:33–72.View ArticlePubMedGoogle Scholar
  2. Li XR. Color atlas of animal parasitosis (Second Edition). Beijing: China Agriculture Press; 2011.Google Scholar
  3. Nzalawahe J, Kassuku AA, Stothard JR, Coles GC, Eisler MC. Trematode infections in cattle in Arumeru District, Tanzania are associated with irrigation. Parasit Vectors. 2014;7:107.View ArticlePubMed CentralPubMedGoogle Scholar
  4. Yamaguti S. A synoptical review of life histories of digenetic trematodes of vertebrates. Tokyo: Keigaku Publishing Co.; 1975.Google Scholar
  5. Li D. A case of Fischoederius elongatus infection in China. Annual Bull Soc Parasitol Guangdong Province. 1991;12(11–13):155–6.Google Scholar
  6. Ramesh A, Small ST, Kloos ZA, Kazura JW, Nutman TB, Serre D, et al. The complete mitochondrial genome sequence of the filarial nematode Wuchereria bancrofti from three geographic isolates provides evidence of complex demographic history. Mol Biochem Parasitol. 2012;183(1):32–41.View ArticlePubMed CentralPubMedGoogle Scholar
  7. Gasser RB, Jabbar A, Mohandas N, Hoglund J, Hall RS, Littlewood DT, et al. Assessment of the genetic relationship between Dictyocaulus species from Bos taurus and Cervus elaphus using complete mitochondrial genomic datasets. Parasit Vectors. 2012;5:241.View ArticlePubMed CentralPubMedGoogle Scholar
  8. Choi KS, Koekemoer LL, Coetzee M. Population genetic structure of the major malaria vector Anopheles funestus s.s. and allied species in southern Africa. Parasit Vectors. 2012;5:283.View ArticlePubMed CentralPubMedGoogle Scholar
  9. Jane EH, Bernard F. Echinostoma and Echinostomiasis. Adv Parasitol. 1990;29:215–69.View ArticleGoogle Scholar
  10. Ghatani S, Shylla JA, Roy B, Tandon V. Multilocus sequence evaluation for differentiating species of the trematode Family Gastrothylacidae, with a note on the utility of mitochondrial COI motifs in species identification. Gene. 2014;548(2):277–84.View ArticlePubMedGoogle Scholar
  11. Wang GL. Laboratory diagnostic techniques of parasites. Feeding Livestock. 2013;3:39–43.Google Scholar
  12. Liu GH, Wang Y, Song HQ, Li MW, Ai L, Yu XL, et al. Characterization of the complete mitochondrial genome of Spirocerca lupi: sequence, gene organization and phylogenetic implications. Parasit Vectors. 2013;6:45.View ArticlePubMed CentralPubMedGoogle Scholar
  13. Gasser RB, Hu M, Chilton NB, Campbell BE, Jex AJ, Otranto D, et al. Single-strand conformation polymorphism (SSCP) for the analysis of genetic variation. Nat Protoc. 2006;1(6):3121–8.View ArticlePubMedGoogle Scholar
  14. Itagaki T, Tsumagari N, Tsutsumi K, Chinone S. Discrimination of three amphistome species by PCR-RFLP based on rDNA ITS2 markers. J Vet Med Sci. 2003;65(8):931–3.View ArticlePubMedGoogle Scholar
  15. Le TH, Blair D, McManus DP. Complete DNA sequence and gene organization of the mitochondrial genome of the liverfluke, Fasciola hepatica L. (Platyhelminthes; Trematoda). Parasitology. 2001;123(Pt 6):609–21.PubMedGoogle Scholar
  16. Shekhovtsov SV, Katokhin AV, Kolchanov NA, Mordvinov VA. The complete mitochondrial genomes of the liver flukes Opisthorchis felineus and Clonorchis sinensis (Trematoda). Parasitol Int. 2010;59(1):100–3.View ArticlePubMedGoogle Scholar
  17. Yan HB, Wang XY, Lou ZZ, Li L, Blair D, Yin H, et al. The mitochondrial genome of Paramphistomum cervi (Digenea), the first representative for the family Paramphistomidae. PLoS One. 2013;8(8):e71300.View ArticlePubMed CentralPubMedGoogle Scholar
  18. Hu M, Jex AR, Campbell BE, Gasser RB. Long PCR amplification of the entire mitochondrial genome from individual helminths for direct sequencing. Nat Protoc. 2007;2(10):2339–44.View ArticlePubMedGoogle Scholar
  19. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25(24):4876–82.View ArticlePubMed CentralPubMedGoogle Scholar
  20. Hu M, Chilton NB, Gasser RB. The mitochondrial genomes of the human hookworms, Ancylostoma duodenale and Necator americanus (Nematoda: Secernentea). Int J Parasitol. 2002;32(2):145–58.View ArticlePubMedGoogle Scholar
  21. Lowe TM, Eddy SR. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997;25(5):955–64.View ArticlePubMed CentralPubMedGoogle Scholar
  22. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28(10):2731–9.View ArticlePubMed CentralPubMedGoogle Scholar
  23. Liu GH, Yan HB, Otranto D, Wang XY, Zhao GH, Jia WZ, et al. Dicrocoelium chinensis and Dicrocoelium dendriticum (Trematoda: Digenea) are distinct lancet fluke species based on mitochondrial and nuclear ribosomal DNA sequences. Mol Phylogenet Evol. 2014;79:325–31.View ArticlePubMedGoogle Scholar
  24. Lee D, Choe S, Park H, Jeon HK, Chai JY, Sohn WM, et al. Complete mitochondrial genome of Haplorchis taichui and comparative analysis with other trematodes. Korean J Parasitol. 2013;51(6):719–26.View ArticlePubMed CentralPubMedGoogle Scholar
  25. Cai XQ, Liu GH, Song HQ, Wu CY, Zou FC, Yan HK, et al. Sequences and gene organization of the mitochondrial genomes of the liver flukes Opisthorchis viverrini and Clonorchis sinensis (Trematoda). Parasitol Res. 2012;110(1):235–43.View ArticlePubMedGoogle Scholar
  26. Littlewood DT, Lockyer AE, Webster BL, Johnston DA, Le TH. The complete mitochondrial genomes of Schistosoma haematobium and Schistosoma spindale and the evolutionary history of mitochondrial genome changes among parasitic flatworms. Mol Phylogenet Evol. 2006;39(2):452–67.View ArticlePubMedGoogle Scholar
  27. Le TH, Blair D, Agatsuma T, Humair PF, Campbell NJ, Iwagami M, et al. Phylogenies inferred from mitochondrial gene orders-a cautionary tale from the parasitic flatworms. Mol Biol Evol. 2000;17(7):1123–5.View ArticlePubMedGoogle Scholar
  28. Nakao M, Sako Y, Ito A. The mitochondrial genome of the tapeworm Taenia solium: a finding of the abbreviated stop codon U. J Parasitol. 2003;89(3):633–5.View ArticlePubMedGoogle Scholar

Copyright

© Yang et al.; licensee BioMed Central. 2015

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Advertisement