Open Access

Erratum to: Development of novel multiplex microsatellite polymerase chain reactions to enable high-throughput population genetic studies of Schistosoma haematobium

  • B. L. Webster1, 2Email author,
  • M. Rabone1,
  • T. Pennance1, 3,
  • A. M. Emery1,
  • F. Allan1,
  • A. Gouvras1,
  • S. Knopp1, 4, 5,
  • A. Garba6,
  • A. A. Hamidou6,
  • K. A. Mohammed7,
  • S. M. Ame7,
  • D. Rollinson1 and
  • J. P. Webster2, 3
Parasites & Vectors20158:519

https://doi.org/10.1186/s13071-015-1134-5

Received: 1 October 2015

Accepted: 1 October 2015

Published: 9 October 2015

The original article was published in Parasites & Vectors 2015 8:432

Unfortunately, the original version of this article [1], contained a mistake. In Table 1, the primers for Sh6 and Sh9 were included incorrectly. Instead of GGGATGTATGCAGACTTG TTGTTTGGCTGCAGTAAC and GCTGAGCTTGAGATTG CTTCTGTCCCATCGATACC they should have been Sh6 Forward Primer GGTGGATTACGCAATAG, Sh6 Reverse Primer TTTAATCAACCGGGTGTC and Sh9 Forward Primer GGGATGTATGCAGACTTG, Sh9 Reverse Primer TTGTTTGGCTGCAGTAAC respectively.
Table 1

Details of the 18 selected microsatellite loci and the characteristics of the two multiplex microsatellite PCR assays. Loci Sh1-15 are from Travis et al., 2013 and Loci C102, C111 and C131 are from Gower et al., 2011. For Niger Ho = 0.596, He = 0.609, for Pemba Ho = 0.599, He = 0.638. The overall Ho = 0.597, He = 0.623

Panel 1

Marker

Forward Primer 5'- 3'

Reverse Primer 5'- 3'

Dye

Size Range (bp)

Repeat

A

Niger

Zanzibar

 

H o

H e

H o

H e

Panel 1

C102

TGTCTCTGTGAATGACCGAAT

TTAGATGAATAATAATGTTGAAACCAC

VIC

184-199

ATT

6

0.42

0.37

0.02

0.02

Sh1

GCATCCAATTTCGTACAC

CCACATTAGGCCAACAAG

VIC

245-284

AAT

13

0.76

0.72

0.84

0.80

Sh14

GTCCTCCTTCCCTCTTTG

CACATTCGTCCTAGATATCG

NED

184-240

ACTC

15

0.94

0.85

0.86

0.88

C131

CTTGTCATTTGGGCATTGTG

CATGGTGAGGTTCAAACGTG

NED

253-265

AAT

4

0.00

0.00

0.00

0.00

Sh6

GGTGGATTACGCAATAG

TTTAATCAACCGGGTGTC

NED

309-321

AAT

7

0.48

0.44

0.84

0.76

Sh9

GGGATGTATGCAGACTTG

TTGTTTGGCTGCAGTAAC

6-FAM

197-227

AAT

11

0.46

0.76

0.46

0.86

Sh3

GCTGAGCTTGAGATTG

CTTCTGTCCCATCGATACC

6-FAM

270-366

AAT

30

0.76

0.86

0.94

0.86

C111

CCCTTGTCTTCAATGCGTTA

GAACGTCTAACTGGCGATCA

PET

201-225

ATT

9

0.74

0.67

0.76

0.68

Sh7

TCCAAGCACCATTATCAAG

ACGGAAACTTGTTGAAATG

PET

293-311

AAT

7

0.46

0.62

0.42

0.48

Panel 2

Sh2

TTAGTGTGTTTGGCTTCAAC

CCTCGAATGAAATCCTGAC

NED

155-218

AAT

21

0.84

0.90

0.56

0.89

Sh5

TGTGCACAAGAAAGATTAAATG

ACGACAATGTTGCAAGTTC

NED

263-314

AAT

16

0.78

0.81

0.36

0.48

Sh13

GAGCAGCTATTTCGTATCG

ACCGTGGACAGTTCATCAG

6-FAM

163-211

AAT

17

0.78

0.72

0.68

0.64

Sh4

CCCATCGCTGATATTAAAG

TCTAGTCGTCTTGGGATCC

6-FAM

268-313

AAT

13

0.84

0.78

0.72

0.79

Sh10

CGCATGTCATACCTATCTCC

GCTTATCAGGCCTATCTCC

PET

183-207

AAT

9

0.18

0.34

0.74

0.70

Sh12

CGTCTTAGTGAGCCAGATG

CTCGTGGACATCATCAG

PET

245-278

AAC

11

0.06

0.06

0.56

0.65

Sh8

CTAAACTGGCAAGATTTC

CAACGTGCCTTTATTTC

PET

282-321

AAT

14

0.76

0.81

0.84

0.83

Sh11

TTGGTTTAGAAATTACATCACC

CCAACAATATTAATGGACAGC

VIC

183-213

ATC

9

0.68

0.58

0.68

0.69

Sh15

CTTTCAGTAGGATTTGTTG

CGACGTCAAGCACTGTAC

VIC

274-301

ATC

10

0.78

0.65

0.50

0.466

Panel = single mulitplex PCR. A = observed number of alleles. Dye = the fluorescent dye label of the forward primer (VIC = green, NED = yellow, 6-FAM = Blue, PET = red). Ho = observed heterozygosity, He = expected heterozygosity

A corrected version of Table 1 is included below.

Notes

Declarations

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Wolfson Wellcome Biomedical Laboratories, Department of Life Sciences, Natural History Museum
(2)
Department of Infectious Disease Epidemiology, Imperial College Faculty of Medicine (St Mary’s Campus)
(3)
RVC Department of Pathology and Pathogen Biology, Centre for Emerging, Endemic and Exotic Diseases (CEEED), Royal Veterinary College, University of London
(4)
Department of Epidemiology and Public Health, Swiss Tropical and Public Health Institute
(5)
University of Basel
(6)
Réseau International Schistosomoses, Environnement, Aménagement et Lutte (RISEAL-Niger)
(7)
Public Health Laboratory - Ivo de Carneri (PHL-IdC)

Reference

  1. Webster BL, Rabone M, Pennance T, Emery AM, Allan F, Gouvras S, et al. Development of novel multiplex microsatellite polymerase chain reactions to enable high-throughput population genetic studies of Schistosoma haematobium. Parasit and Vectors. 2015;8:432.View ArticleGoogle Scholar

Copyright

© Webster et al. 2015

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Advertisement