Open Access

Exposure to vector-borne pathogens in candidate blood donor and free-roaming dogs of northeast Italy

  • Marta Vascellari1,
  • Silvia Ravagnan1,
  • Antonio Carminato1,
  • Stefania Cazzin1,
  • Erika Carli1,
  • Graziana Da Rold1,
  • Laura Lucchese1,
  • Alda Natale1,
  • Domenico Otranto2 and
  • Gioia Capelli1Email author
Parasites & Vectors20169:369

https://doi.org/10.1186/s13071-016-1639-6

Received: 14 March 2016

Accepted: 10 June 2016

Published: 29 June 2016

Abstract

Background

Many vector-borne pathogens including viruses, bacteria, protozoa and nematodes occur in northeast Italy, representing a potential threat to animal and human populations. Little information is available on the circulation of the above vector-borne pathogens in dogs. This work aims to (i) assess exposure to and circulation of pathogens transmitted to dogs in northeast Italy by ticks, sandflies, and mosquitoes, and (ii) drive blood donor screening at the newly established canine blood bank of the Istituto Zooprofilattico Sperimentale delle Venezie.

Methods

Blood samples from 150 privately-owned canine candidate blood donors and 338 free-roaming dogs were screened by serology (IFA for Leishmania infantum, Ehrlichia canis, Anaplasma phagocythophilum, Babesia canis, Rickettsia conorii, R. rickettsii), microscopic blood smear examination, and blood filtration for Dirofilaria spp. All candidate donors and seropositive free-roaming dogs were tested by PCR for L. infantum, E. canis, A. phagocythophilum, Babesia/Theileria and Rickettsia spp. The dogs had no clinical signs at the time of sampling.

Results

Overall, 40 candidate donors (26.7 %) and 108 free-roaming dogs (32 %) were seroreactive to at least one vector-borne pathogen. Seroprevalence in candidate donors vs free-roaming dogs was: Leishmania infantum 6.7 vs 7.1 %; Anaplasma phagocytophilum 4.7 vs 3.3 %; Babesia canis 1.3 vs 2.7 %; Ehrlichia canis none vs 0.9 %; Rickettsia conorii 16 vs 21.3 % and R. rickettsii 11 vs 14.3 %. Seroreactivity to R. rickettsii, which is not reported in Italy, is likely a cross-reaction with other rickettsiae. Filariae, as Dirofilaria immitis (n = 19) and D. repens (n = 2), were identified in free-roaming dogs only. No significant differences were observed between candidate donors and free-roaming dogs either in the overall seroprevalence of vector-borne pathogens or for each individual pathogen. All PCRs and smears performed on blood were negative.

Conclusions

This study demonstrated that dogs are considerably exposed to vector-borne pathogens in northeast Italy. Although the dog owners reported regularly using ectoparasiticides against fleas and ticks, their dogs had similar exposure to vector-borne pathogens as free-roaming dogs. This prompts the need to improve owner education on the use of insecticidal and repellent compounds in order to reduce the risk of arthropod bites and exposure to vector-borne pathogens. Based on the absence of pathogens circulating in the blood of healthy dogs, the risk of transmission of these pathogens by blood transfusion seems to be low, depending also on the sensitivity of the tests used for screening.

Keywords

Vector-borne pathogens Canine blood donors Free-roaming dogs Exposure IFAT Real-time PCR Italy

Background

Several vector-borne pathogens (VBPs), transmitted by ticks, mosquitoes and sandflies, occur in dogs living in northeast Italy. Infection and/or disease are caused by members of the genera Anaplasma, Babesia, Borrelia, Dirofilaria, Ehrlichia, Leishmania, and Rickettsia [17]. Some of these infections can be life-threatening in dogs (leishmaniosis, cardiopulmonary filariosis, babesiosis) and, in some cases, in humans (leishmaniosis, dirofilariosis, anaplasmosis) [6].

The occurrence of a VBP in a given area is directly dependent on the presence of reservoir hosts and the density of the vectors. For example, the distribution of arthropod vectors in northeast Italy is well known as regards mosquitoes due to the presence of surveillance programs for West Nile virus [8, 9] and other arboviruses transmitted by the tiger mosquitoes, Aedes albopictus [10, 11]. Culex pipiens, Ae. albopictus, Ochlerotatus caspius and Ae. vexans have been identified as the most widespread mosquitoes in the area, including the novel invasive species, Aedes koreicus, which has recently been detected [12] and is expanding [13, 14]. All of the above mosquito species have been proven or are suspected to be vectors of Dirofilaria spp. [1518].

Ixodes ricinus is the most widespread tick species in northeast Italy and has repeatedly been found to be infected with VBPs that can also affect dogs, i.e. Borrelia burgdorferi (s.l.), Rickettsia helvetica, R. monacensis, Anaplasma phagocytophilum, Candidatus Neoehrlichia mikurensis, Babesia spp. [1924]. However, the most common tick species removed from dogs of north Italy is Rhipicephalus sanguineus, followed by I. hexagonus, I. ricinus and Dermacentor marginatus [21, 25, 26]. No studies are available on the vectorial role of Rh. sanguineus in north Italy.

Two species of sandfly, Phlebotomus perniciosus and P. neglectus, have been reported in northeast Italy [4, 27, 28], where they are probably responsible for the transmission of L. infantum to dogs.

Several VBPs can also be transmitted by blood transfusion. The safety of donated blood with respect to VBPs is guaranteed by serological and molecular screening of dog donors. The Consensus Statements of the American College of Veterinary Internal Medicine (ACVIM) for blood transfusion [29] recommend that donors be screened for VBPs in accordance with the following criteria: (i) the agent is known to be present in the territory; (ii) the agent is known to be potentially transmitted by blood transfusion; (iii) the agent is capable of causing subclinical infection in candidate blood donors; (iv) the disease in the recipient is severe or difficult to foresee. Hence knowledge of VBP circulation among dog populations is pivotal to estimating the risk of transmission by transfusion.

In this study, we assessed exposure to and circulation of pathogens transmitted by ticks, sandflies and mosquitoes to dogs in northeast Italy, including free-roaming dogs and candidate blood donors at the newly established canine Blood Bank of the Istituto Zooprofilattico Sperimentale delle Venezie.

Methods

Dogs

From January 2014 to December 2015, a total of 488 dogs, including candidate blood donors (CBD) (n = 150) and free-roaming dogs (FRD) (n = 338), were sampled in several municipalities of the provinces of north and northeast Italy (municipalities of Padua, Treviso, Verona, Venice, Milan and Bologna).

The breed, age, gender and location of the dogs are reported in Table 6.

CBDs were privately-owned dogs and included animals (n = 41) from two dog breeders. According to Italian Ministry of Health guidelines (http://tinyurl.com/h7vs3lz), candidate donor dogs need to fulfil the following inclusion criteria: age 2–8 years, body weight ≥ 25 kg, clinically healthy, regularly vaccinated and protected against endo- and ectoparasites.

The FRDs included dogs with no identification (microchip) and privately-owned dogs allowed to wander around, especially in peri-urban and rural areas. According to the Italian law on Companion Animals and the Prevention of Stray Animals (Act no. 281/1991), FRDs are captured by the Local Veterinary Service, housed in shelters and sampled soon after capture. Conversely, CBDs were sampled at their first clinical visit. Whole blood and sera were tested by serology, PCR, blood smear examination, and blood filtration.

Ethical statement

Informed consent was obtained from the owners of CBDs, as required by the Blood Bank to become eligible donors. The donor screening programme included the collection of information on the health history of the dogs and infectious disease testing. FRDs were sampled and underwent a clinical evaluation by the Local Veterinary Health units at the time of entry to the shelter, as part of the zoonotic agent control programme.

Diagnostic procedures

Serology

Dog sera were tested by means of indirect immunofluorescence assay (IFA) to detect and quantify IgG antibodies against L. infantum, E. canis, A. phagocythophilum, B. canis, R. conorii and R. rickettsii. The latter pathogen is not reported in the Old World but was included in the screening battery in an attempt to detect cross-reactions with rickettsiae other than R. conorii. The in-house assay for L. infantum was performed according to the procedure described in the OIE Terrestrial Manual [30]. The serum screening dilution was set at 1:40.

The detection of IgG antibodies against the other pathogens was carried out using commercial kits following the manufacturers’ instructions. The kits were: the Ehrlichia canis Canine IFA IgG Kit (Fuller Laboratories, Fullerton, California, USA), serum screening dilution 1:50; the Canine Granulocytic Anaplasmosis IgG IFA Kit (Fuller Laboratories, Fullerton, California, USA), serum screening dilution 1:80; Fluo Babesia canis (Agrolabo S.p.A., Scarmagno, Italy), serum screening dilution 1:16; the Rickettsia conorii Canine IFA IgG Kit, and the Rickettsia rickettsii Canine IFA IgG Kit (Fuller Laboratories, Fullerton, California, USA), serum screening dilution 1:64. Positive and negative controls were added to each slide of the in-house and commercial kits. Two-fold serial dilutions were prepared and tested to define the serum titre of samples testing positive at screening.

Molecular analyses

DNA was extracted from EDTA-blood samples using a DNeasy Blood & Tissue kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s instructions. The samples were screened for Babesia/Theileria spp., Rickettsia spp., Leishmania spp. and Ehrlichia canis, using in-house SYBR Green Real-Time PCR (rPCR) assays, performed with the primers from [3134] (Table 1). The reactions were carried out in a total volume of 20 μl, containing 10 μl of QuantiFast SYBR Green PCR Master mix 2X (Qiagen GmbH, Germany), sense and reverse primer (concentration reported in Table 1) and 3 μl of extracted DNA. Amplifications were performed in a StepOnePlus™ instrument (Applied Biosystems, Foster City, CA). The thermal profile consisted of 5 min of activation at 95 °C, followed by 40 cycles at 95 °C for 15 s (denaturation), specific annealing temperature (Table 1) for 30 s (annealing) and 60 °C for 30 s (extension). Following amplification, a melting curve analysis was performed by slowly raising the temperature of the thermal chamber from 60 °C to 95 °C to distinguish between specific amplicons and non-specific amplification products. Anaplasma phagocytophilum DNA was amplified by conventional PCR targeting the major surface protein gene (msp2), as described elsewhere [35]. To ensure the effectiveness of the nucleic acid extraction, a PCR targeting the 18S rRNA gene internal control was applied [36]. Negative (sterile water) and positive controls (DNA of Theileria orientalis, Rickettsia felis, Leishmania infantum, Ehrlichia canis and Anaplasma phagocytophilum) were included in each run.
Table 1

Target genes and rPCR primers used in this study for pathogen identification

Target organism

Gene

Primer

Sequence (5'-3')

Pc

(μM)

TA

(°C)

Reference

Babesia/Theileria

18S rRNA

BJ1

GTCTTGTAATTGGAATGATGG

0.1

60

[31]

  

BN2

TAGTTTATGGTTAGGACTACG

0.1

  

Rickettsia spp.

rompB

RompB OFm

GTAACCGGAARTAATCGTTTCGT

0.1

58

[32]

  

RompB ORm

GCTTTATAACCAGCTAAACCRCC

0.1

  

Leishmania spp.

COII

COII F

GGCATAAATCCATGTAAGA

0.3

52

[33]

  

COII R

TGGCTTTTATATTATCATTTT

0.3

  

Ehrlichia canis

16S rRNA

CANIS

CAATTATTTATAGCCTCTGGCTATAGGA

0.5

60

[34]

  

CA1UR

GAGTTTGCCGGGACTTCTTCT

0.5

  

AbbreviationsTA temperature of annealing; Pc primer concentration

16S rRNA = gene coding 16S ribosomal RNA; rompB = Rickettsial Outer Membrane Protein B gene; COII = Cytochrome c  oxidase subunit II gene ; 18S rRNA = gene coding 18S ribosomal RNA

Blood smear examination

The blood smears were stained (Diff Quick Stain Set, Medion Diagnostic AG, Duedingen, SZ) and examined for the presence of any pathogens, i.e. L. infantum, Babesia spp., Hepatozoon canis, A. phagocytophilum, A. platys, E. canis and microfilariae.

Filariae screening and identification

One ml of blood in ethylene diamine tetraacetic acid (EDTA) was tested by standard filtration test and staining. The number of microfilariae per millilitre (mf/ml) was calculated as the average of ten counts serially performed on 10 μl of blood samples. The identification of microfilariae was based on their morphology and morphometry [37]. The samples suspected to be positive for D. repens were confirmed by PCR and sequencing [38].

Statistical analysis

The differences between CBDs and FRDs in the prevalence of VBPs for each pathogen and each data element collected on the dogs (breed, gender, age and location) were analysed by the Chi-square test or Fisher’s exact test, where appropriate. Significance was set at P < 0.01. The agreement between serological status for R. conorii/R. rickettsii and for A. phagocytophilum/E. canis was tested using the kappa coefficient [39]. SPSS for Windows, version 13.0 software was used.

Results

None of the dogs had any clinical signs of VBDs at the time of sampling. The owners of CBDs reported regularly using compounds to control fleas and ticks and taking preventative measures against filariae, while no information was available for FRDs.

Overall, 40 CBDs (26.7 %) and 108 FRDs (32.0 %) were seroreactive to at least one VBP, as shown in Table 2. No significant differences were observed between CBDs and FRDs in the overall seroprevalence of VBPs or for each individual pathogen.
Table 2

Serological results and positivity for filariae in candidate blood donors and free-roaming dogs of northeastern Italy, 2014-2015

Pathogens

Candidate blood donors

Free-roaming dogs

 

No. examined

No. positive

%

No. examined

No. positive

%

Anaplasma phagocytophilum

150

7

4.7

338

11

3.3

Babesia canis

104

0

0

338

3

0.9

Ehrlichia canis

150

2

1.3

338

9

2.7

Leishmania infantum

150

10

6.7

336

24

7.1

Rickettsia conorii

150

24

16.0

338

72

21.3

Rickettsia rickettsii

109

12

11.0

336

48

14.3

R. conorii and R. rickettsii

109

12

11.0

336

33

9.82

Dirofilaria spp.

150

0

0

330

21

6.4

Seropositivity was most frequently detected against rickettsiae (26 % in CBDs vs 24.3 % in FRDs), followed by L. infantum (~7 % in both groups).

Twenty-six of the CBDs (17.3 %) were seroreactive to one test only, 13 (8.7 %) to two and 1 (0.7 %) to three (details in Table 3). Of the FRDs, 56 dogs (16.6 %) were seroreactive to one test only, 43 (12.7 %) to two, 7 (2.1 %) to three and 1 (0.3 %) to four (details in Table 4).
Table 3

Candidate blood donors seroreactive to several antigens (n = 40)

Candidate donor no.

Ap

Bc

Ec

Li

Rc

Rr

1

0

ne

0

1:40

0

ne

2

0

0

0

1:40

1:64

0

3

1:80

0

0

0

0

0

4

0

0

0

1:80

0

0

5

1:80

0

0

0

0

0

6

0

0

0

0

1:64

0

7

0

ne

0

1:40

0

ne

8

1:160

0

0

0

0

0

9

1:160

0

0

0

0

0

10

0

ne

0

0

1:64

ne

11

1:80

ne

0

0

0

ne

12

0

ne

0

0

1:512

ne

13

0

0

0

0

1:128

0

14

0

0

0

0

1:64

1:64

15

1:80

0

0

0

1:512

1:512

16

0

0

0

0

1:128

0

17

0

0

0

0

1:64

1:64

18

0

ne

0

1:40

0

0

19

0

ne

0

0

1:64

ne

20

0

0

0

0

1:256

1:256

21

0

0

0

0

1:64

1:64

22

0

ne

0

1:40

0

ne

23

0

ne

0

1:40

0

ne

24

0

ne

0

1:40

0

ne

25

0

0

0

1:1280

1:256

0

26

0

ne

0

0

1:256

ne

27

0

0

0

0

1:64

1:64

28

0

0

0

0

1:64

0

29

0

0

0

0

1:64

0

30

0

0

0

0

1:64

1:64

31

0

0

0

0

1:64

1:64

32

0

0

0

0

1:8192

1:2048

33

0

0

0

0

1:64

1:64

34

0

0

1:80

0

0

0

35

0

ne

1:50

0

0

ne

36

0

0

0

0

1:64

0

37

0

0

0

0

1:128

1:128

38

0

ne

0

1:40

0

ne

39

1:80

0

0

0

0

0

40

0

0

0

0

1:128

1:256

AbbreviationsApAnaplasma phagocytophilum; Bc, Babesia canis; Ec, Ehrlichia canis; Li, Leishmania infantum; Rc, Rickettsia conorii; Rr, Rickettsia rickettsii; ne, not examined

Table 4

Free-roaming dogs seroreactive to several antigens (n = 108)

Free-roaming dog no.

Ap

Bc

Ec

Li

Rc

Rr

1

0

0

0

0

1:128

1:128

2

0

0

0

0

1:64

0

3

0

0

0

1:40

0

0

4

0

0

0

0

1:128

1:128

5

0

0

0

0

1:128

0

6

0

0

1:50

0

0

0

7

0

0

1:50

0

0

0

8

0

0

0

0

1:64

0

9

0

0

0

0

1:256

1:256

10

0

0

0

0

1:64

0

11

0

0

1:50

0

0

0

12

0

0

1:50

0

1:128

0

13

0

0

0

0

1:64

0

14

0

0

0

0

1:128

0

15

0

0

0

0

1:128

0

16

0

0

0

0

1:64

0

17

0

0

0

0

1:512

1:128

18

0

0

0

1:40

1:128

0

19

0

0

0

1:40

1:256

0

20

0

0

0

0

0

1:64

21

0

0

0

0

1:64

0

22

0

0

0

0

1:128

0

23

0

0

1:50

0

0

0

24

0

0

0

0

0

1:64

25

0

0

0

0

1:64

1:64

26

0

0

0

0

1:64

1:64

27

0

0

0

0

1:64

0

28

0

0

0

0

1:64

1:64

29

0

0

1:50

0

1:64

1:64

30

0

0

1:400

0

0

0

31

0

0

0

0

1:512

1:256

32

0

0

0

0

1:2048

1:2048

33

1:80

0

0

1:40

1:1024

1:512

34

0

0

0

1:40

0

0

35

0

0

0

1:40

1:64

0

36

0

0

0

0

1:128

0

37

0

0

0

0

1:128

1:128

38

0

0

0

1:40

1:1024

1:256

39

1:80

0

0

1:40

0

0

40

0

0

0

0

1:64

0

41

0

0

0

0

1:128

0

42

0

0

0

0

1:128

0

43

0

0

0

0

1:64

0

44

0

0

0

1:40

1:256

1:1280

45

0

0

0

0

1:64

1:64

46

0

0

0

1:40

0

0

47

0

0

0

0

1:64

0

48

0

0

0

0

1:128

0

49

1:160

0

0

0

0

0

50

1:320

0

0

ne

1:64

ne

51

0

0

0

ne

1:256

ne

52

0

0

0

0

1:64

1:64

53

0

0

0

0

1:64

1:64

54

0

0

0

1:40

0

0

55

1:160

0

0

1:40

1:64

0

56

0

0

0

1:40

0

0

57

0

0

0

0

0

1:64

58

1:160

0

0

0

1:256

1:256

59

1:320

0

0

1:40

0

0

60

0

0

0

1:40

0

0

61

0

0

0

0

1:64

0

62

0

0

0

0

1:64

0

63

0

1:16

0

0

1:256

0

64

1:80

0

0

0

1:64

0

65

0

0

0

0

0

1:1024

66

0

0

0

0

1:1024

1:2048

67

0

0

0

0

1:1024

1:2048

68

0

0

0

0

1:256

1:256

69

0

0

0

1:40

0

0

70

0

0

0

1:40

0

0

71

0

0

0

1:40

1:128

1:64

72

0

0

0

1:40

1:128

0

73

0

0

0

0

1:128

1:64

74

0

0

0

0

1:256

1:64

75

0

0

0

0

1:128

0

76

1:80

0

0

0

0

1:64

77

0

0

0

0

0

1:64

78

0

0

0

0

1:64

1:256

79

0

0

0

0

1:64

0

80

0

0

0

0

1:64

1:64

81

0

0

0

1:40

0

1:64

82

1:80

0

0

0

1:256

1:512

83

0

0

0

0

1:256

1:512

84

0

0

0

0

1:1024

0

85

0

0

0

0

1:64

0

86

0

0

0

0

1:64

0

87

0

0

0

0

0

1:128

88

0

0

0

0

1:256

1:128

89

0

0

0

0

0

1:64

90

0

0

0

0

1:128

1:128

91

0

0

1:50

0

0

0

92

0

0

0

0

1:64

1:256

93

0

0

1:100

0

0

0

94

0

0

0

0

0

1:64

95

0

0

0

0

0

1:64

96

1:5120

0

0

0

0

0

97

0

0

0

0

1:512

1:1024

98

0

0

0

1:40

0

0

99

0

1:16

0

0

0

0

100

0

1:16

0

0

0

0

101

0

0

0

1:40

0

0

102

0

0

0

0

1:64

1:64

103

0

0

0

0

1:64

1:256

104

0

0

0

0

1:64

1:128

105

0

0

0

1:40

0

0

106

0

0

0

0

1:128

1:128

107

0

0

0

0

1:64

1:64

108

0

0

0

1:40

0

0

Abbreviations: ApAnaplasma phagocytophilumBcBabesia canisEcEhrlichia canisLiLeishmania infantumRcRickettsia conorii; RrRickettsia rickettsiine, not examined

The most common seropositivity for two antigens in the same dog (co-reaction) was for R. conorii and R. rickettsii, in both groups of dogs (Tables 3 and 4). Specifically, of the 101 dogs testing positive for Rickettsia spp., 49 (48.5 %) were positive for both rickettsiae, 41 (40.6 %) exclusively for R. conorii and 11 (10.9 %) exclusively for R. rickettsii, the latter all being FRDs. Agreement between seropositivity for the two rickettsiae was moderate (k = 0.586), suggesting a certain degree of cross-reactivity. Conversely, seroreactivity for A. phagocytophilum and E. canis was completely discordant (k = -0.29), suggesting that these antigens did not cross-react in our test.

The distribution of antibody titres was similar between CBDs and FRDs (P > 0.05) (Table 5).
Table 5

Distribution of antibody titres for each pathogen in candidate blood donors and free-roaming dogs in northeast Italy, 2014–2015

Pathogensa

Candidate blood donors

Free-roaming dogs

 

Pos 1st dilution

Pos 2nd dilution

Pos > 2nd dilution

Max. titre

Pos 1st dilution

Pos 2nd dilution

Pos > 2nd dilution

Max. titre

Anaplasma phagocytophilum

5

2

0

1:160

5

3

3

1:5120

Babesia canis

0

0

0

3

0

0

1:16

Ehrlichia canis

1

1

0

1:100

7

1

1

1:400

Leishmania infantum

8

1

1

1:1280

24

0

0

1:40

Rickettsia conorii

14

4

6

1:8192

33

19

20

1:2048

Rickettsia rickettsii

7

1

4

1:2048

22

9

17

1:2048

a Serum screening dilution: Ap (1:80); Bc (1:16); Ec (1:50); Li (1:40); Rc (1:64); Rr (1:64)

Among the dogs testing positive for L. infantum, only one dog showed a high antibody titre, consistent with clinical leishmaniosis (1:1280). The antibody titre for R. conorii or R. rickettsii was above 1: 320 (Table 5) in a total of 26 dogs (5.3 %). The 12 CBDs testing positive to both species of Rickettsia showed very similar titres. Conversely, 10 (27 %) of the 37 FRDs presenting co-reactions had a higher titre for R. rickettsii.

No significant differences were found between seropositivity and the data given in Table 6.
Table 6

Breed, age, gender and location of the dogs according to seropositivity

Data

A. phagocythophilum

B. canis

E. canis

L. infantum

R. conorii

R. rickettsii

 

pos/tested (%)

pos/tested (%)

pos/tested (%)

pos/tested (%)

pos/tested (%)

pos/tested (%)

Breed

 crossbreed

10/327 (3.1)

3/323 (0.9)

9/327 (2.8)

23/327 (7.0)

68/327 (20.8)

46/323 (14.2)

 other breed

7/153 (4.6)

0/111 (0)

2/153 (1.3)

11/153 (7.2)

25/153 (16.3)

13/116 (11.2)

Age (months)

 ≤12

2/91 (2.2)

1/91 (1.1)

1/91 (1.1)

9/91 (9.9)

16/91 (17.6)

10/91 (11.0)

 >12 ≤ 36

5/88 (5.7)

1/72 (1.4)

0/87 (0)

11/87 (12.6)

15/87 (17.2)

7/74 (9.5)

 >36 ≤ 60

3/69 (4.3)

1/59 (1.7)

1/70 (1.4)

3/69 (4.3)

9/69 (13.0)

8/59 (13.6)

 > 60

4/68 (5.9)

0/61 (0)

0/69 (0)

2/69 (2.9)

14/69 (20.3)

14/63 (22.2)

Gender

 female

11/177 (6.2)

1/148 (0.7)

3/177 (1.7)

13/176 (7.4)

30/176 (17.0)

16/150 (10.7)

 male

6/303 (2.0)

2/286 (0.7)

8/304 (2.6)

21/304 (6.9)

64/304 (21.1)

44/289 (15.2)

Location

 Padua

9/226 (4.0)

3/225 (1.3)

2/228 (0.9)

16/226 (7.1)

41/227 (18.1)

34/223 (15.2)

 Treviso

2/157 (1.3)

0/140 (0)

7/158 (4.4)

10/157 (6.4)

39/157 (24.8)

18/140 (12.9)

 Venice

3/59 (5,1)

0/43 (0)

0/59 (0)

4/59 (6.8)

8/59 (13.6)

5/48 (10.4)

 Other

4/46 (8.7)

0/34 (0)

2/46 (4.3)

4/46 (8.7)

8/46 (17.4)

3/34 (8.8)

Microfilariae were found exclusively in FRDs (n = 21; 6.4 %) (χ 2  = 9.982, df = 1, P = 0.0016) and were identified as D. immitis (n = 19) and D. repens (n = 2). All dogs testing positive for microfilariae were from the province of Padua (21/219; 9.6 %). The microfilariae of D. immitis per ml of blood (mf/ml) ranged from 4 to 26,620 (mean = 413), and numbered 26 and 14,440 mf/ml, respectively, in the two dogs found positive for D. repens.

All PCRs and smears performed on blood were negative.

Discussion

This study has demonstrated that dogs are considerably exposed to VBPs in northeast Italy. The most frequent pathogens encountered by dogs in this area are members of the genus Rickettsia. Considering that R. rickettsii (the agent of Rocky Mountain Spotted Fever) is not reported in the Old World, the seroreactivity to this pathogen in the dogs in our study was the effect of a cross-reaction with other rickettsiae, as reported elsewhere [41] and stated in the instructions accompanying the serological kit used. The following species of Rickettsia were detected in north Italy: R. helvetica and R. monacensis, a common finding in Ixodes ricinus ticks [19, 20, 24], and R. slovaca and R. raoultii, detected in Dermacentor marginatus ticks removed from wild boars [42]. The circulation of many other Rickettsia spp. is reported in hosts and vectors in central and southern Italy, the most common being R. massiliae, R. aeschlimannii and R. conorii israeliensis [25, 43, 44].

Rickettsia conorii (the agent of the Mediterranean Spotted Fever), has been detected almost exclusively in southern Italy, in both humans [40] and dogs [2]. It can therefore be argued that a certain level of seroreactivity to this antigen is due to a cross-reaction with other Rickettsia spp.

The high rate of exposure to rickettsiae and the low rate of exposure to A. phagocytophilum of the dogs in our study is consistent with the rate of infection found in Ixodes ricinus in the same area between 2005 and 2008 (i.e. 13.1 % and 3.7 % for R. helvetica and R. monacensis, respectively, and 1.5 % for A. phagocytophilum) [24].

In our survey, three FRDs had high titres for A. phagocytophilum, without any evident clinical signs, indicating either a previous infection or a subclinical/mild infection in dogs not subjected to laboratory testing to carefully evaluate their clinical status. However, in a previous study using an IFA test, seroprevalence was not significantly different between sick (47 %) and healthy dogs (40 %) [45].

Our dogs were found to have a very low rate of exposure to other pathogens transmitted by Rhipicephalus ticks (Ehrlichia and Babesia) compared to studies performed in central [46] and southern Italy [47, 48], which reported seroprevalence to be up to 46 % for E. canis and as high as 70 % for Babesia spp. This is likely due to the lower abundance of the brown dog tick of the Rh. sanguineus group in the northern compared to southern Italy, where warmer temperatures throughout the year may contribute to increasing tick abundance [49].

In addition, many studies have suggested that vector competence of different populations (haplotypes or sibling species) of the R. sanguineus group may vary, reviewed in [50]. However, populations of R. sanguineus have never been accurately mapped in northern Italy.

The second pathogen to which FRDs and CBD dogs are exposed is L. infantum. All but one of the animals showed a serological titre below 1:80, a cut-off not usually indicative of infection [51] and thus requiring confirmation by other tests or seroconversion. The IFA used in this study showed no [52], or a very low rate of, cross-reaction with other VBPs [53], suggesting that the seroreactivity is most likely due to contact with an infected sandfly.

This is consistent with the history of Leishmania in northern regions. Indeed, 20 years ago canine leishmaniosis was regarded as an infection “imported” from endemic areas of the south. The scenario has quickly changed [5], with new foci continuing to emerge in northern regions [4, 54, 55] and phlebotomine vectors recently being found in the northernmost part of the eastern Italian Alps [27].

Detection of D. immitis and D. repens in FRDs indicate that both nematodes are still circulating in the area of investigation, particularly in the lowlands around Padua. Northeastern Italy is an endemic area for D. immitis, with prevalences of up to 80 % being reported in the past [5, 56]. Surveys performed in the 1990s in the same province found 67 % of 175 stray dogs at the local municipality shelter to be infected by D. immitis [57]. At the end of the 1990s, contact between a mosquito infected by D. immitis and a host was estimated to occur every four nights for dogs and within two weeks for humans [7]. In subsequent years, after the advent of efficient preventative measures, the prevalence of heartworm infection dramatically decreased, especially in urban areas (unpublished data). However, in rural areas, both D. immitis and D. repens are still circulating, as demonstrated by the positivity of the FRDs taking part in this study and the presence of infected mosquitoes. The screening in 2010 of over 10,000 mosquitoes captured in the same area as this study revealed the presence of D. immitis, alone or in combination with D. repens, in 13 and two of the 20 monitored sites, respectively [17].

Despite the considerable rate of exposure to VBPs, none of the study dogs presented evident clinical signs and/or circulating pathogens at the time of sampling. This is not surprising, since the detection of pathogens in the bloodstream can be difficult even in clinical cases [1, 2, 41, 5961]. A study performed on 650 sick dogs, yielded positive PCR results for Rickettsia spp. in 0.4, 1.4 and 3.3 % of dogs from northern, central and southern Italy, respectively [2]. Another study was unable to find A. phagocytophilum and Rickettsia spp. in 135 sick Italian dogs and found a low prevalence of E. canis (1.8 %) in 54 dogs in the north [58].

Conversely, in dogs showing clinical signs consistent with babesiosis, the pathogen is often detected both by blood smear examination and PCR [60, 61]. In north Italy, Babesia canis was found by PCR in 30/103 sick dogs (29 %) and B. vogeli in 1/103 (0.9 %) [61]. However, 55 % of the dogs infected by B. canis had travelled in eastern Europe, where babesiosis and the tick vector Dermacentor reticulatus are endemic [62], and were therefore likely to be imported cases.

The comparable rate of exposure to pathogens transmitted by ticks and sandflies in CBDs and FRDs was unexpected considering that CBD owners are very careful about their dogs’ health, including the control of ectoparasites and prevention of dirofilariosis. Conversely, less or no care was expected to be taken of FRDs. This assumption is strengthened by the fact that positivity for filariae was found exclusively in FRDs, while the owners of CBDs proved to correctly use prophylactic measures against dirofilariosis. The similar seroprevalence for VBPs in the two groups may be explained by limited or incorrect use of compounds with repellent activity against arthropod vectors, as demonstrated by the results of a questionnaire administered to dog and cat owners in Portugal [63]. Repellents have in fact been proven to prevent vector bites and consequently the transmission of pathogens, even in highly endemic areas of south Italy [47, 6466].

Our results confirm that serological positivity against tick-borne pathogens, even with very high titres, has to be carefully considered. Clinical observations, sensitive PCRs and repeated serological tests must be applied to confirm acute or chronic infections caused by rickettsial agents [41]. In addition, more specific, commercially available serological rickettsial assays, coupled with deeper knowledge of the pathogenic potential of the different species, are greatly required.

Although exposure to VBPs is frequent for dogs living in northeast Italy, our results suggest that the risk of transmission by blood transfusion is low, if donors are carefully selected. Specifically, in areas endemic for Ixodes spp., it may be difficult to identify donors that are seronegative for Anaplasma spp. and Rickettsia spp. It might, therefore, be acceptable to use seropositive but PCR negative dogs as donors in such situations [67]. Conversely, serological screening for E. canis and L. infantum remains mandatory, since the antibody titres are predictive of infection. Finally, the diffusion and prevalence of other pathogens, such as Bartonella and haemoplasmas, should be investigated, as recommended by the updated Consensus Statements of the American College of Veterinary Internal Medicine (ACVIM) [67].

Conclusions

This study has improved our knowledge on the circulation of important VBPs in northeast Italy and has demonstrated a considerable rate of exposure to VBPs among dog populations. Although owners of CBDs reported regularly using compounds against fleas and ticks, their dogs had similar exposure to vector-borne pathogens as free-roaming dogs. This prompts the need to improve owner education on the use of repellent compounds in order to prevent arthropod bites and, consequently, the transmission of VBPs. The seroreactivity of CBDs to all the screened VBPs reinforces the need to continue applying this panel of PCRs at each blood donation. The test panel should also be continually revised according to additional information gathered on the introduction of pathogens and/or vectors from endemic areas.

Abbreviations

VBP, vector-borne pathogen; CBD, candidate blood donors; FRD, free-roaming dogs; ACVIM, American College of Veterinary Internal Medicine; PCR, polymerase chain reaction; EDTA, Ethylene Diamine Tetraacetic Acid; DNA, Deoxyribonucleic acid; rRNA, ribosomal ribonucleic acid; IFA, Immunofluorescence Assay.

Declarations

Acknowledgments

The authors are grateful to Alberto Camerini, Riccardo Friso, Alfio Bortolini, Aldo Costa and Giovanni Dal Maso of the Local Veterinary Units for their help in the recruitment of dogs and sampling. The authors are very grateful to the owners of the dogs for their contribution to canine blood donation. The authors wish to thank Joanne Fleming for the English language revision.

Funding

This work was supported by an Italian Ministry of Health grant (project code RC-IZSVE 03/2013).

The publication of the paper has been sponsored by Bayer Animal Health in the framework of the 11th CVBD World Forum Symposium.

Availability of data and materials

Data supporting the conclusions of this article are included within the article.

Authors’ contribution

MV and GC conceived the study and wrote the paper; MV and AC performed the sampling and clinical evaluation of the dogs; EC performed the blood smear examinations, SR, GDR and SC performed the biomolecular screening, and AN and LL the serological screening; DO revised the paper and contributed to the background and discussion. All the authors revised and approved the MS.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable

Ethical approval and consent to participate

All samples were collected by professional vets in veterinary facilities and used with the owner consent (CBDs) or collected by the Local Veterinary Health Unit (FRDs). The study did not involve any experimental work, therefore no ethical committee approval was required.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Istituto Zooprofilattico Sperimentale delle Venezie
(2)
Dipartimento di Medicina Veterinaria, Università degli Studi di Bari

References

  1. Solano-Gallego L, Trotta M, Razia L, Furlanello T, Caldin M. Molecular survey of Ehrlichia canis and Anaplasma phagocytophilum from blood of dogs in Italy. Ann N Y Acad Sci. 2006;1078:515–8.View ArticlePubMedGoogle Scholar
  2. Solano-Gallego L, Trotta M, Caldin M, Furlanello T. Molecular survey of Rickettsia spp. in sick dogs in Italy. Zoonoses Public Health. 2008;55(8–10):521–5.PubMedGoogle Scholar
  3. Iori A, Gabrielli S, Calderini P, Moretti A, Pietrobelli M, Tampieri MP, Galuppi R, Cancrini G. Tick reservoirs for piroplasms in central and northern Italy. Vet Parasitol. 2010;170(3-4):291–6.View ArticlePubMedGoogle Scholar
  4. Maroli M, Rossi L, Baldelli R, Capelli G, Ferroglio E, Genchi C, et al. The northward spread of leishmaniasis in Italy: evidence from retrospective and ongoing studies on the canine reservoir and phlebotomine vectors. Trop Med Int Health. 2008;13(2):256–64.View ArticlePubMedGoogle Scholar
  5. Otranto D, Capelli G, Genchi C. Changing distribution patterns of canine vector borne diseases in Italy: leishmaniosis vs. dirofilariosis. Parasit Vectors. 2009;2 Suppl 1:S2.View ArticlePubMedGoogle Scholar
  6. Otranto D, Dantas-Torres F. Canine and feline vector-borne diseases in Italy: current situation and perspectives. Parasit Vectors. 2010;3:2.View ArticlePubMedPubMed CentralGoogle Scholar
  7. Capelli G, Frangipane di Regalbono A, Simonato G, Cassini R, Cazzin S, Cancrini G, et al. Risk of canine and human exposure to Dirofilaria immitis infected mosquitoes in endemic areas of Italy. Parasit Vectors. 2013;6:60.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Mulatti P, Bonfanti L, Capelli G, Capello K, Lorenzetto M, Terregino C, et al. West Nile virus in north-eastern Italy, 2011: entomological and equine IgM-based surveillance to detect active virus circulation. Zoonoses Public Health. 2013;60(5):375–82.View ArticlePubMedGoogle Scholar
  9. Calzolari M, Pautasso A, Montarsi F, Albieri A, Bellini R, Bonilauri P, et al. West Nile virus surveillance in 2013 via mosquito screening in northern Italy and the influence of weather on virus circulation. PLoS One. 2015;10(10):e0140915.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Gobbi F, Capelli G, Angheben A, Giobbia M, Conforto M, Franzetti M, et al. Human and entomological surveillance of West Nile fever, dengue and chikungunya in Veneto Region, Italy, 2010–2012. BMC Infect Dis. 2014;14:60.View ArticlePubMedPubMed CentralGoogle Scholar
  11. Grisenti M, Vázquez A, Herrero L, Cuevas L, Perez-Pastrana E, Arnoldi D, et al. Wide detection of Aedes flavivirus in north-eastern Italy--a European hotspot of emerging mosquito-borne diseases. J Gen Virol. 2015;96(Pt 2):420–30.View ArticlePubMedGoogle Scholar
  12. Capelli G, Drago A, Martini S, Montarsi F, Soppelsa M, Delai N, et al. First report in Italy of the exotic mosquito species Aedes (Finlaya) koreicus, a potential vector of arboviruses and filariae. Parasit Vectors. 2011;4:188.View ArticlePubMedPubMed CentralGoogle Scholar
  13. Montarsi F, Drago A, Martini S, Calzolari M, De Filippo F, Bianchi A, et al. Current distribution of the invasive mosquito species, Aedes koreicus [Hulecoeteomyia koreica] in northern Italy. Parasit Vectors. 2015;8:614.View ArticlePubMedPubMed CentralGoogle Scholar
  14. Marcantonio M, Metz M, Baldacchino F, Arnoldi D, Montarsi F, Capelli G, et al. First assessment of potential distribution and dispersal capacity of the emerging invasive mosquito Aedes koreicus in Northeast Italy. Parasit Vectors. 2016;9(1):63.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Cancrini G, Frangipane di Regalbono A, Ricci I, Tessarin C, Gabrielli S, Pietrobelli M. Aedes albopictus is a natural vector of Dirofilaria immitis in Italy. Vet Parasitol. 2003;118(3–4):195–202.View ArticlePubMedGoogle Scholar
  16. Cancrini G, Romi R, Gabrielli S, Toma L, DI Paolo M, Scaramozzino P. First finding of Dirofilaria repens in a natural population of Aedes albopictus. MedVet Entomol. 2003;17(4):448–51.Google Scholar
  17. Latrofa MS, Montarsi F, Ciocchetta S, Annoscia G, Dantas-Torres F, Ravagnan S, et al. Molecular xenomonitoring of Dirofilaria immitis and Dirofilaria repens in mosquitoes from north-eastern Italy by real-time PCR coupled with melting curve analysis. Parasit Vectors. 2012;5:76.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Montarsi F, Ciocchetta S, Devine G, Ravagnan S, Mutinelli F, Frangipane di Regalbono A, et al. Development of Dirofilaria immitis within the mosquito Aedes (Finlaya) koreicus, a new invasive species for Europe. Parasit Vectors. 2015;8:177.View ArticlePubMedPubMed CentralGoogle Scholar
  19. Beninati T, Lo N, Noda H, Esposito F, Rizzoli A, Favia G, Genchi C. First detection of spotted fever group Rickettsiae in Ixodes ricinus from Italy. Emerg Infect Dis. 2002;8:983–6.View ArticlePubMedPubMed CentralGoogle Scholar
  20. Floris R, Yurtman AN, Margoni EF, Mignozzi K, Boemo B, Altobelli A, Cinco M. Detection and identification of Rickettsia species in the northeast of Italy. Vector Borne Zoonotic Dis. 2008;8:777–82.View ArticlePubMedGoogle Scholar
  21. Cassini R, Zanutto S, Frangipane di Regalbono A, Gabrielli S, Calderini P, Moretti A, et al. Canine piroplasmosis in Italy: epidemiological aspects in vertebrate and invertebrate hosts. Vet Parasitol. 2009;165(1–2):30–5.View ArticlePubMedGoogle Scholar
  22. Nazzi F, Martinelli E, Del Fabbro S, Bernardinelli I, Milani N, Iob A, et al. Ticks and Lyme borreliosis in an alpine area in northeast Italy. Med Vet Entomol. 2010;24(3):220–6.PubMedGoogle Scholar
  23. Tagliapietra V, Rosà R, Arnoldi D, Cagnacci F, Capelli G, Montarsi F, et al. Saturation deficit and deer density affect questing activity and local abundance of Ixodes ricinus (Acari, Ixodidae) in Italy. Vet Parasitol. 2011;183(1–2):114–24.View ArticlePubMedGoogle Scholar
  24. Capelli G, Ravagnan S, Montarsi F, Ciocchetta S, Cazzin S, Porcellato E, et al. Occurrence and identification of risk areas of Ixodes ricinus-borne pathogens: a cost-effectiveness analysis in north-eastern Italy. Parasit Vectors. 2012;5:61.View ArticlePubMedPubMed CentralGoogle Scholar
  25. Trotta M, Nicetto M, Fogliazza A, Montarsi F, Caldin M, Furlanello T, et al. Detection of Leishmania infantum, Babesia canis, and Rickettsiae in ticks removed from dogs living in Italy. Ticks Tick Borne Dis. 2012;3(5–6):294–7.View ArticlePubMedGoogle Scholar
  26. Baráková I, Derdáková M, Carpi G, Rosso F, Collini M, Tagliapietra V, et al. Genetic and ecologic variability among Anaplasma phagocytophilum strains, northern Italy. Emerg Infect Dis. 2014;20(6):1082–5.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Morosetti G, Bongiorno G, Beran B, Scalone A, Moser J, Gramiccia M, et al. Risk assessment for canine leishmaniasis spreading in the north of Italy. Geospat Health. 2009;4(1):115–27.View ArticlePubMedGoogle Scholar
  28. Signorini M, Cassini R, Drigo M, Frangipane di Regalbono A, Pietrobelli M, Montarsi F, Stensgaard AS. Ecological niche model of Phlebotomus perniciosus, the main vector of canine leishmaniasis in north-eastern Italy. Geospat Health. 2014;9(1):193–201.View ArticlePubMedGoogle Scholar
  29. Wardrop KJ, Reine N, Birkenheuer A, Hale A, Hohenhaus A, Crawford C, Lappin MR. Canine and feline blood donor screening for infectious disease. J Vet Intern Med. 2005;19(1):135–42.View ArticlePubMedGoogle Scholar
  30. OIE/WHO. Manual of diagnostic tests and vaccines for terrestrial animals 2014. Chapter 2.1.8. (available at: http://www.oie.int/international-standard-setting/terrestrial-manual/access-online/)Google Scholar
  31. Casati S, Sager H, Gern L, Piffaretti JC. Presence of potentially pathogenic Babesia sp. for human in Ixodes ricinus in Switzerland. Ann Agric Environ Med. 2006;13:65–70.PubMedGoogle Scholar
  32. Choi YJ, Jang WJ, Kim JH, Ryu JS, Lee SH, Park KH, et al. Spotted fever group and Typhus Group Rickettsioses in Humans, South Korea. Emerg Infect dDis. 2005;11- N° 2:237–44.View ArticleGoogle Scholar
  33. Sharief AH, Khalil E-TAG, Barker DC, Omer SA, Abdalla HS, Ibrahim ME. Simple and direct characterization of Leishmania donovani isolates based on cytochrome oxidase II gene sequences. Open Trop Med J. 2011;4:1–5.View ArticleGoogle Scholar
  34. Nazari M, Lim SY, Watanabe M, Sharma RSK. Molecular detection of Ehrlichia canis in dogs in Malaysia. PLoS Negl Trop Dis. 2013;7:e1982.View ArticlePubMedPubMed CentralGoogle Scholar
  35. Massung RF, Slater KG. Comparison of PCR assays for detection of the agent of human granulocytic ehrlichiosis, Anaplasma phagocytophilum. J Clin Microbiol. 2003;41(2):717–22.View ArticlePubMedPubMed CentralGoogle Scholar
  36. Smith J, McElhinney LM, Heaton PR, Black ER, Lowings JP. Assessment of template quality by the incorporation of an internal control into a RT-PCR for the detection of rabies and rabies-related viruses. J Virol Methods. 2000;4:107–15.View ArticleGoogle Scholar
  37. Euzeby J. Diagnostic expérimental des helminthoses animals (animaux domestiques, animaux de laboratoire, primates): travaux pratiques d’helmenthologie vétérinaire/Jacques Euzeby, J., Livre 1: Généralites, diagnostic ante mortem. IXth ed. Paris: Informations Techniques des Services Vétérinaires; 1981. p. 349.Google Scholar
  38. Latrofa MS, Dantas-Torres F, Annoscia G, Genchi M, Traversa D, Otranto D. A duplex real-time polymerase chain reaction assay for the detection of and differentiation between Dirofilaria immitis and Dirofilaria repens in dogs and mosquitoes. Vet Parasitol. 2012;185(2–4):181–5.View ArticlePubMedGoogle Scholar
  39. Viera JA, Garrett MJ. Understanding interobserver agreement: The Kappa statistic. Fam Med. 2005;37(5):360–3.PubMedGoogle Scholar
  40. Solano-Gallego L, Caprì A, Pennisi MG, Caldin M, Furlanello T, Trotta M. Acute febrile illness is associated with Rickettsia spp. infection in dogs. Parasit Vectors. 2015;8:216.View ArticlePubMedPubMed CentralGoogle Scholar
  41. Maioli G, Pistone D, Bonilauri P, Pajoro M, Barbieri I, Mulatto P, et al. Etiological agents of rickettsiosis and anaplasmosis in ticks collected in Emilia-Romagna region (Italy) during 2008 and 2009. Exp Appl Acarol. 2012;57(2):199–208.View ArticlePubMedGoogle Scholar
  42. Chisu V, Masala G, Foxi C, Socolovschi C, Raoult D, Parola P. Rickettsia conorii israelensis in Rhipicephalus sanguineus ticks, Sardinia, Italy. Ticks Tick Borne Dis. 2014;5(4):446–8.View ArticlePubMedGoogle Scholar
  43. Mancini F, Ciccozzi M, Lo Presti A, Cella E, Giovanetti M, Di Luca M, et al. Characterization of spotted fever group Rickettsiae in ticks from a city park of Rome, Italy. Ann Ist Super Sanita. 2015;51(4):284–90.PubMedGoogle Scholar
  44. Ciceroni L, Pinto A, Ciarrocchi S, Ciervo A. Current knowledge of rickettsial diseases in Italy. Ann N Y Acad Sci. 2006;1078:143–9.View ArticlePubMedGoogle Scholar
  45. Kohn B, Silaghi C, Galke D, Arndt G, Pfister K. Infections with Anaplasma phagocytophilum in dogs in Germany. Res Vet Sci. 2011;91(1):71–6.View ArticlePubMedGoogle Scholar
  46. Ebani VV, Bertelloni F, Torracca B, Cerri D. Serological survey of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, and Ehrlichia canis infections in rural and urban dogs in Central Italy. Ann Agric Environ Med. 2014;21(4):671–5.View ArticlePubMedGoogle Scholar
  47. Otranto D, Paradies P, Testini G, Latrofa MS, Weigl S, Cantacessi C, et al. Application of 10 % imidacloprid/50 % permethrin to prevent Ehrlichia canis exposure in dogs under natural conditions. Vet Parasitol. 2008;153(3–4):320–8.View ArticlePubMedGoogle Scholar
  48. Pennisi MG, Caprì A, Solano-Gallego L, Lombardo G, Torina A, Masucci M. Prevalence of antibodies against Rickettsia conorii, Babesia canis, Ehrlichia canis, and Anaplasma phagocytophilum antigens in dogs from the Stretto di Messina area (Italy). Ticks Tick Borne Dis. 2012;3(5–6):315–8.View ArticlePubMedGoogle Scholar
  49. Gray J, Dantas-Torres F, Estrada-Peña A, Levin M. Systematics and ecology of the brown dog tick, Rhipicephalus sanguineus. Ticks Tick Borne Dis. 2013;4(3):171–80.View ArticlePubMedGoogle Scholar
  50. Dantas-Torres F, Otranto D. Further thoughts on the taxonomy and vector role of Rhipicephalus sanguineus group ticks. Vet Parasitol. 2015;208(1–2):9–13.View ArticlePubMedGoogle Scholar
  51. Solano-Gallego L, Koutinas A, Miró G, Cardoso L, Pennisi MG, Ferrer L, et al. Directions for the diagnosis, clinical staging, treatment and prevention of canine leishmaniosis. Vet Parasitol. 2009;165(1–2):1–18.View ArticlePubMedGoogle Scholar
  52. Mettler M, Grimm F, Capelli G, Camp H, Deplazes P. Evaluation of enzyme-linked immunosorbent assays, an immunofluorescent-antibody test, and two rapid tests (immunochromatographic-dipstick and gel tests) for serological diagnosis of symptomatic and asymptomatic Leishmania infections in dogs. J Clin Microbiol. 2005;43(11):5515–9.View ArticlePubMedPubMed CentralGoogle Scholar
  53. Solano-Gallego L, Villanueva-Saz S, Carbonell M, Trotta M, Furlanello T, Natale A. Serological diagnosis of canine leishmaniosis: comparison of three commercial ELISA tests (Leiscan, ID Screen and Leishmania 96), a rapid test (Speed Leish K) and an in-house IFAT. Parasit Vectors. 2014;7:111.View ArticlePubMedPubMed CentralGoogle Scholar
  54. Ferroglio E, Romano A, Passera S, D’Angelo A, Guiso P, Ghiggi E, et al. Dogs’ parasite and zoonotic risk: from old to new “emergencies” in the North-West of Italy. Parassitologia. 2006;48(1–2):115–6.PubMedGoogle Scholar
  55. Cassini R, Signorini M, Frangipane di Regalbono A, Natale A, Montarsi F, Zanaica M, et al. Preliminary study of the effects of preventive measures on the prevalence of Canine Leishmaniosis in a recently established focus in northern Italy. Vet Ital. 2013;49(2):157–61.PubMedGoogle Scholar
  56. Genchi C, Kramer LH, Prieto G. Epidemiology of canine and feline dirofilariasis, a global view. In: Simón F, Genchi C, editors. Heartworm Infection in Humans and Animals. Salamanca: Ediciones Universidad de Salamanca; 2001:121–134.Google Scholar
  57. Capelli G, Poglayen G, Bertotti F, Giupponi S, Martini M. The host-parasite relationship in canine heartworm infection in a hyperendemic area of Italy. Vet Res Commun. 1996;20(4):320–30.View ArticlePubMedGoogle Scholar
  58. Otranto D, Testini G, Dantas-Torres F, Latrofa MS, Diniz PP, de Caprariis D, et al. Diagnosis of canine vector-borne diseases in young dogs: a longitudinal study. J Clin Microbiol. 2010;48(9):3316–24.View ArticlePubMedPubMed CentralGoogle Scholar
  59. de Caprariis D, Dantas-Torres F, Capelli G, Mencke N, Stanneck D, Breitschwerdt EB, et al. Evolution of clinical, haematological and biochemical findings in young dogs naturally infected by vector-borne pathogens. Vet Microbiol. 2011;149(1–2):206–12.View ArticlePubMedGoogle Scholar
  60. Solano-Gallego L, Trotta M, Carli E, Carcy B, Caldin M, Furlanello T. Babesia canis canis and Babesia canis vogeli clinicopathological findings and DNA detection by means of PCR-RFLP in blood from Italian dogs suspected of tick-borne disease. Vet Parasitol. 2008;157(3–4):211–21.View ArticlePubMedGoogle Scholar
  61. Trotta M, Fogliazza A, Furlanello T, Solano-Gallego L. A molecular and serological study of exposure to tick-borne pathogens in sick dogs from Italy. Clin Microbiol Infect. 2009;15 Suppl 2:62–3.View ArticlePubMedGoogle Scholar
  62. Rubel F, Brugger K, Pfeffer M, Chitimia-Dobler L, Didyk YM, Leverenz S, et al. Geographical distribution of Dermacentor marginatus and Dermacentor reticulatus in Europe. Ticks Tick Borne Dis. 2016;7(1):224–33.View ArticlePubMedGoogle Scholar
  63. Matos M, Alho AM, Owen SP, Nunes T, Madeira de Carvalho L. Parasite control practices and public perception of parasitic diseases: A survey of dog and cat owners. Prev Vet Med. 2015;122(1–2):174–80.View ArticlePubMedGoogle Scholar
  64. Otranto D, Paradies P, Lia RP, Latrofa MS, Testini G, Cantacessi C, et al. Efficacy of a combination of 10 % imidacloprid/50 % permethrin for the prevention of leishmaniasis in kennelled dogs in an endemic area. Vet Parasitol. 2007;144(3–4):270–8.View ArticlePubMedGoogle Scholar
  65. Otranto D, Dantas-Torres F, de Caprariis D, Di Paola G, Tarallo VD, Latrofa MS, et al. Prevention of canine leishmaniosis in a hyper-endemic area using a combination of 10 % imidacloprid/4.5 % flumethrin. PLoS One. 2013;8(2):e56374.View ArticlePubMedPubMed CentralGoogle Scholar
  66. Brianti E, Gaglio G, Napoli E, Falsone L, Prudente C, Solari Basano F, et al. Efficacy of a slow-release imidacloprid (10 %)/flumethrin (4.5 %) collar for the prevention of canine leishmaniosis. Parasit Vectors. 2014;7:327.View ArticlePubMedPubMed CentralGoogle Scholar
  67. Wardrop KJ, Birkenheuer A, Blais MC, Callan MB, Kohn B, Lappin MR, Sykes J. Update on canine and feline blood donor screening for blood-borne pathogens. Vet Intern Med. 2016;30(1):15–35.View ArticleGoogle Scholar

Copyright

© The Author(s). 2016

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.