- Research
- Open Access
- Published:
Genetic diversity of Aedes aegypti and Aedes albopictus from cohabiting fields in Hainan Island and the Leizhou Peninsula, China
Parasites & Vectors volume 16, Article number: 319 (2023)
Abstract
Background
Aedes aegypti and Ae. albopictus are important human arbovirus vectors that can spread arboviral diseases such as yellow fever, dengue, chikungunya and Zika. These two mosquito species coexist on Hainan Island and the Leizhou Peninsula in China. Over the past 40 years, the distribution of Ae. albopictus in these areas has gradually expanded, while Ae. aegypti has declined sharply. Monitoring their genetic diversity and diffusion could help to explain the genetic influence behind this phenomenon and became key to controlling the epidemic of arboviruses.
Methods
To better understand the genetic diversity and differentiation of these two mosquitoes, the possible cohabiting areas on Hainan Island and the Leizhou Peninsula were searched between July and October 2021, and five populations were collected. Respectively nine and 11 microsatellite loci were used for population genetic analysis of Ae. aegypti and Ae. albopictus. In addition, the mitochondrial coxI gene was also selected for analysis of both mosquito species.
Results
The results showed that the mean diversity index (PIC and SI values) of Ae. albopictus (mean PIC = 0.754 and SI = 1.698) was higher than that of Ae. aegypti (mean PIC = 0.624 and SI = 1.264). The same results were also observed for the coxI gene: the genetic diversity of all populations of Ae. albopictus was higher than that of Ae. aegypti (total H = 45 and Hd = 0.89958 vs. total H = 23 and Hd = 0.76495, respectively). UPGMA dendrogram, DAPC and STRUCTURE analyses showed that Ae. aegypti populations were divided into three clusters and Ae. albopictus populations into two. The Mantel test indicated a significant positive correlation between genetic distance and geographic distance for the Ae. aegypti populations (R2 = 0.0611, P = 0.001), but the correlation was not significant for Ae. albopictus populations (R2 = 0.0011, P = 0.250).
Conclusions
The population genetic diversity of Ae. albopictus in Hainan Island and the Leizhou Peninsula was higher than that of Ae. aegypti. In terms of future vector control, the most important and effective measure was to control the spread of Ae. albopictus and monitor the population genetic dynamics of Ae. aegypti on Hainan Island and the Leizhou Peninsula, which could theoretically support the further elimination of Ae. aegypti in China.
Graphical Abstract

Background
Aedes-borne viruses (arboviruses) have always been a major global health concern. Dengue, yellow fever, chikungunya and Zika threaten approximately 3.9 billion people living in tropical and subtropical areas [1]. Aedes aegypti and Ae. albopictus are the main vectors of these arboviruses worldwide, and their high ecological and physiological plasticity has facilitated their current global distribution [2]. Aedes aegypti originated in Africa, and its distribution in China has been limited to a few provinces, including Hainan Island and the Leizhou Peninsula in Guangdong Province [3]. However, Ae. albopictus, which originated in Asia and is also known as the Asian tiger mosquito, has spread to all continents except for Antarctica and is considered the most invasive mosquito species [4, 5]. Aedes albopictus is widespread in China, extending to Liaoning Province in the north, Gansu Province in the northwest and Hainan Province in the south [6].
The two mosquito species coexist on Hainan Island and the Leizhou Peninsula, the main dengue epidemic areas at the southernmost tip of mainland China. There were two dengue epidemics on Hainan Island at the end of the twentieth century and one on Leizhou Peninsula at the beginning of the twenty-first century. Aedes aegypti was the vector of transmission in these outbreaks [7,8,9,10]. More recently, however, Ae. albopictus has become the main vector, and the breeding areas of Ae. aegypti on these two islands have gradually decreased over the last 40 years. Guangxi was the first province in China to declare Ae. aegypti eradication. Between 1986 and 1991, Guangxi carried out comprehensive control of Ae. aegypti by application of insecticides, fish culture in water jars and other methods and achieved the goal of eliminating Ae. aegypti from the entire province in just 6 years [11]. Aedes aegypti was not found during subsequent monitoring, but Ae. albopictus densities were very high [12]. Various explanations have been proposed for the displacement of Ae. aegypti by Ae. albopictus, including interspecific competition [13], satyrization [14,15,16] and differential adaptability to environmental changes [17].
Genetic diversity and population structure are fundamental to understanding population dynamics and dispersal [18]. Genetic structure and variation are related to many factors, including vector control campaigns, levels of urbanization, trade flows between cities and the number of colonization events [19]. There are some reports on the genetic characteristics of Ae. aegypti and Ae. albopictus populations in China. For Ae. aegypti, most of the research has focused on the genetic characteristics of invaded Ae. aegypti populations in Yunnan Province [3, 20,21,22,23]. For Ae. albopictus, much research has been done on its genetic diversity and population structure in different areas of China at different scales. At the national level, some studies have shown that continuous dispersal supported by human activities has contributed to strong gene flow, inhibiting population differentiation and promoting genetic diversity among Ae. albopictus populations, and that climatic factors may also influence genetic diversity. [24,25,26,27,28,29]. There are also many provincial reports on the genetic diversity of Ae. albopictus populations in different regions of China, such as Guangdong, Zhejiang, Fujian and Hunan Provinces [30,31,32,33], which all suggest low differentiation of Ae. albopictus populations. At the regional level, the rapid expansion of high-speed railways, air routes and highways has accelerated the dispersal of mosquitoes in the Yangtze River basin, inhibiting population differentiation and promoting genetic diversity among Ae. albopictus [34]. However, in their cohabiting areas such as Hainan Island and the Leizhou Peninsula, there were no reports on the genetic diversity of Ae. aegypti, or the different dispersal pattern with Ae. albopictus in the sympatric areas, especially the genetic reasons for the change in population size of these two species in the past 40 years.
In Vietnam, a high degree of genetic polymorphism was found in invasive Ae. aegypti mosquitoes. Individual abundance of Ae. aegypti and Ae. albopictus was also influenced by climate and habitat in the sympatric region [2]. In Penang, Ae. albopictus was found in most areas, and it was postulated that the species is beginning to replace Ae. aegypti and may become the primary vector of dengue virus [35]. In Central Africa, Ae. albopictus is the dominant species in most urban areas located below 6°N where it tends to replace the native Ae. aegypti [36]. On the other hand, it was found that the coexistence of Ae. albopictus and Ae. aegypti in the same geographical areas may increase the risk of infection or co-infection for humans, especially during outbreaks or arboviral expansions [1]. Most studies focus on monitoring the densities of these two mosquito species or conduct population genetics research on a single species in China. However, there is no report on the difference in genetic diversity and dispersal patterns between Ae. albopictus and Ae. aegypti in cohabiting fields, especially based on the different shift in distribution and densities of two species.
In the present study, the genetic diversity of Ae. aegypti and Ae. albopictus collected from the cohabiting areas of Hainan Island and the Leizhou Peninsula was assessed, based on microsatellite molecular markers in DNA (SSR) and mitochondrial DNA marker (coxI). Understanding the population genetic dynamics between these two mosquitoes could help to understand why the distribution of Ae. aegypti has decreased significantly while the distribution of Ae. albopictus has increased on Hainan Island and the Leizhou Peninsula over the last 40 years. On the other hand, it also has important implications for vector control strategies in China, especially in the plan to eliminate Ae. aegypti on the Leizhou Peninsula and further reduce Ae. aegypti on Hainan Island.
Methods
Sample collection and DNA extraction
Larvae, pupae and adult Ae. aegypti and Ae. albopictus were collected from five cohabiting areas in Hainan Island and the Leizhou Peninsula from July to October 2021 (Table 1 and Fig. 1). All the developmental stages of mosquitoes were brought back to a field laboratory. The larvae and pupae were reared until adult mosquitoes emerged. The species of all adult mosquitoes were identified based on morphology [6]. Adult mosquitoes were stored in sterile tubes containing anhydrous ethanol prior to DNA extraction. Whole genomic DNA was extracted individually from each mosquito using a DNeasy® Blood & Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s standard protocol, and extracted DNA was stored at − 20 °C prior to subsequent experiments.
Microsatellite DNA genotyping and data analysis
Nine microsatellite loci (AT1, AG2, AG7, AC2, AC7, B07, F06, SQM6 and SQM7) and 11 microsatellite loci (BW-P1, BW-P3, BW-P6, BW-P18, BW-P22, BW-P23, BW-P24, BW-P26, BW-P27, BW-P35 and BW-P36) (Additional file 1: Table S1) were selected for amplification by PCR using fluorescence-labeled primers for Ae. aegypti and Ae. albopictus, respectively, based on previous research [3, 28, 37]. Amplified fragments were separated by capillary electrophoresis, and the microsatellite DNA fragments were entered into Excel for analysis. GenAlex v.6.5 was used to estimate the pairwise genetic relatedness between individuals by the LRM estimator. The coefficient of relatedness r ≥ 0.25 was used to define a full sib relationship (parents and offspring, or sibs sharing the same parents) [38, 39]. To reduce the sibling bias within populations for genetic structure analysis, only one individual was selected from each putative full-sibling group within each population. In addition, genetic diversity within each cohabiting area was estimated using the average number of alleles (Na), effective number of alleles (Ne), Shannon’s diversity index (SI), observed heterozygosity (Ho), expected heterozygosity (He) and interpopulation variation assessed by AMOVA using GenAlEx v.6.5 [39]. The DAPC analysis was performed on the R platform using the “Adegenet” data analysis module and mobilizing the “inbreeding and seppop” commands to test the normality of inbreeding coefficients for different populations [40]. In addition, population genetic structure was assessed in STRUCTURE 2.3.4 software, and optimal K values were calculated using the ΔK method [41, 42], with the best K value calculated using Structure Harvester, https://taylor0.biology.ucla.edu/structureHarvester/. The output data were subjected to 1000 iterations using the greedy algorithm of CLUMPP v.1.1.2 [43] and finally visualized and analyzed using DISTRUCT v.1.1 [44]. Polymorphic information content (PIC) was assessed using the Microsatellite Toolkit [45]. The null allele frequency of each locus, deviation from Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium (LD) were calculated using GENEPOP version 4.1.4 [46]. To detect bottlenecks, the SIGN test for heterozygosity excess was performed with TPM in BOTTLENECK v.1.2.02 [47]. In addition, NTSYS v2.10e was used to plot the UPGMA tree based on Nei's genetic distance, and GenAlex v.6.5 was used for the genetic correlation test (Mantel test).
Mitochondrial DNA sequencing and phylogenetic analysis
The whole mitochondrial coxI gene of Aedes mosquitoes was amplified using the following primer pairs: coxI-F: 5′GGTCAACAAATCATAAAGATATTGG3′ and coxI-R: 5′ TCCAATGCACTAATCTGCCATATTA3′ [48, 49]. The 25 µl reaction mixtures contained 12.5 µl PCR Mix (TaKaRa, Japan), 8.5 µl ddH2O (TaKaRa, Japan), 1 µl forward primers and 1 µl reverse primers (synthesized by Sangon Biotech), with 2 µl DNA template. The PCR amplification consisted of a 5-min pre-denaturation at 94 °C followed by 35 cycles of 94 °C for 30 s, 60 for 45 s and 72 °C for 60 s, with a final elongation at 72 °C for 5 min, using the BIORAD (USA) thermal cycler. All the PCR products were detected and separated by 2% agarose gel electrophoresis, and the positive PCR products were bidirectionally sequenced by Beijing Genomics Institution (BGI), China. The sequences were checked by the BioEdit and alignmented by cluster W, and the mutation sites were determined. Sequences were sorted in Mega v7 for subsequent data analysis. The base content and polymorphism were analyzed by Mega v7 [50]. Haplotype index (number of haplotypes-H, haplotype diversity-Hd, nucleotide diversity-π, average number of nucleotide differences-k) and mismatch distribution analysis of Aedes populations were calculated by DnaSP v6.12.03 [51], and the haplotype network diagram was plotted by Popart v1.7 [52]. Molecular variance (AMOVA), neutrality test (Tajima’s D and Fu’s Fs) and Fst test with the calculation Nm = (1/Fst + 1)/4 were calculated in ARLEQUIN v3.1 [53].
Results
Sampling data and species identification
Possible breeding sites of Ae. aegypti on Hainan Island and the Leizhou Peninsula from July to October 2021 were searched and surveyed, and the results were consistent with previous reports stating that the breeding sites specific for Ae. aegypti have been greatly reduced [10, 54,55,56]. Only five populations co-habiting with Ae. albopictus were collected, one from the Leizhou Peninsula and four from Hainan Island (Table 1). In contrast, Ae. albopictus was present in all sites searched. Species identification was performed 3 days after the emergence of adult mosquitoes. We collected both female and male mosquitoes because we believe that the study of genetic diversity should include both sexes, consistent with the approach of other studies [57].
Genetic diversity based on microsatellite DNA
We excluded 46 Ae. aegypti and 15 Ae. albopictus samples of full siblings at collection sites, and the remaining 140 Ae. aegypti and 130 Ae. albopictus samples were used for further molecular analysis (Table 1). The pairwise genetic relatedness of all samples within and between populations was compared using the LRM estimator (Additional file 2: Table S2). Aedes aegypti had a greater number of within-population comparisons (total percentage 1.06%) than Ae. albopictus (0.64%).
The genetic diversity of the nine microsatellite loci for Ae. aegypti and the 11 microsatellite loci for Ae. albopictus are shown in Table 2. The Na, PIC and SI values of each locus were consistent, indicating that most loci were polymorphic in both Aedes populations [27, 28]. The diversity index of Ae. albopictus was higher than that of Ae. aegypti. The results of null allele evaluation indicated that loci F06, BW-P1 and BW-P27 had a high probability of null alleles (> 0.2) [58,59,60]. The mean value of observed heterozygosity (Ho) was lower than the expected heterozygosity (He) in all the Aedes populations. A test of Hardy-Weinberg equilibrium (HWE) at each locus per population indicated that all ten populations were significantly departed from HWE (Additional file 3: Table S3). Significant results for the linkage disequilibrium (LD) test were obtained for 31 out of 180 pairs (17.2%) in Ae. aegypti and 55 out of 275 pairs (20.0%) in Ae. albopictus. The TPM model was used to assess the recent population bottleneck and showed a significant difference (P < 0.05) in the BS population of Ae. aegypti (Table 3). Analysis of molecular variance (AMOVA) showed that most of the variation occurred within the populations, with percentages of variation of 90.7% for Ae. aegypti and 96.4% for Ae. albopictus, respectively (Additional file 4: Table S4). The results of UPGMA cluster analysis were shown in Fig. 2A, D, which indicated that Ae. aegypti populations were clustered into three branches and Ae. albopictus populations were clustered into two branches. In addition, the results of the DAPC analysis were similar to those of the cluster analysis (Fig. 2B, E). The STRUCTURE analysis also suggested that Ae. aegypti could be divided into three genetic clusters, while Ae. albopictus could be divided into two (Fig. 2C, F). The Mantel test showed a positive correlation between genetic distance and geographical distance (R2 = 0.0611, P = 0.001 for Ae. aegypti and R2 = 0.0011, P = 0.250 for Ae. albopictus).
Genetic diversity based on the mitochondrial coxI gene
Base polymorphism and haplotype diversity of the final 1330 bp coxI genes are shown in Table 4. The nucleotide composition was A + T rich for both Aedes species, consistent with the characteristics of insect mitochondrial DNA (accession numbers: OR144884-OR144906 for Ae. aegypti and OR144827-OR144871 for Ae. albopictus) [61]. High haplotype diversity was found in all the populations (Hd = 0.45977–0.77083 for Ae. aegypti, Hd = 0.77083–0.88966 for Ae. albopictus), except for the YGH population of Ae. aegypti (Hd = 0.45977), contrasting with low nucleotide diversity (π = 0.00066–0.00346 for Ae. aegypti, π = 0.00111–0.00262 for Ae. albopictus). A total of 23 haplotypes were recorded from 140 individuals of Ae. aegypti (Fig. 3). The WS population had the largest number of haplotypes (8), followed by the HW (6) and YGH (6) populations. In comparison, the number of haplotypes from Ae. albopictus was relatively higher. A total of 45 haplotypes were recorded from 130 individuals of Ae. albopictus (Fig. 3). The HW population had the largest number of haplotypes (15), followed by the YGH (14) and HT (9) populations. The two Aedes mosquito species in BS had the lowest number of haplotypes (4 and 8, respectively). There were three shared haplotypes and 20 unique haplotypes in Ae. aegypti populations with the dominant haplotypes being Hap_2. There were 4 shared haplotypes and 41 unique haplotypes in Ae. albopictus populations with the dominant haplotypes being Hap_4, Hap_18 and Hap_26.
In the neutrality test (Additional file 5: Table S5), Tajima’s D showed that only the HW Ae. aegypti and Ae. albopictus populations had experienced population expansion. A negative value of Fu’s FS for Ae. aegypti was obtained only for YGH, but the P values were > 0.05. In contrast, among the Ae. albopictus populations, three (YGH, HT and HW) had experienced population expansion.
AMOVA showed that most of the variation occurred within populations, with 84.6% and 87.8% percentage variations, respectively (Additional file 4: Table S4). The mismatch distribution analysis used to estimate the historical population dynamics is shown in Fig. 4 and indicated population expansion (unimodal) in the YGH and HT populations of Ae. aegypti and the YGH, HT and HW populations of Ae. albopictus.
Pairwise Fst values indicated that most pairs were significantly different (P < 0.05), except for the BS and HW, HT and HW population pairs of Ae. albopictus. The Nm calculated by Fst showed that most pairwise values were > 1, indicating frequent communication between most populations (Additional file 6: Table S6).
Discussion
Hainan Island and the Leizhou Peninsula are cohabiting fields of Ae. aegypti and Ae. albopictus in China. Aedes aegypti used to be the main vector species of dengue; however, with the development of the economy and changes in the ecological environment, Ae. albopictus has become the main vector species in these areas [62,63,64]. Only five Ae. aegypti populations were sampled that were cohabiting with Ae. albopictus, whereas Ae. albopictus was ubiquitous in all researched areas. Some studies have reported that Ae. aegypti had a relatively short active range compared to other mosquitoes [65]. In recent years, the distribution of Ae. aegypti in these areas has become increasingly restricted, and they could only be found in a few fishing villages along the coast. The sharp decline in Ae. aegypti over the last 40 years is closely linked to the vector control measures and ecological reconstruction of these villages, which have greatly altered the mosquito breeding environment. However, the distribution of Ae. albopictus in these areas might have increased because of its strong environmental adaptability. The present study investigated the reasons for the decline of Ae. aegypti and the expansion of Ae. albopictus on Hainan Island and the Leizhou Peninsula based on population genetics studies.
Genetic diversity
According to the microsatellite DNA results, the mean diversity index (PIC and SI values) of Ae. albopictus was higher than that of Ae. aegypti, indicating that the population diversity of Ae. albopictus was greater and it was better able to adapt environmental changes than populations of Ae. aegypti. Microsatellite DNA are widely used to evaluate genetic diversity and population structure because of the advantages of simple operation, easy detection and high polymorphism [66, 67]; the microsatellite DNA results in the present study showed that most loci were polymorphic [27, 28]. Mitochondrial coxI gene with strict maternal inheritance, conservative genetic structure and moderate evolution rate is also an effective molecular marker to study the genetic structure of mosquitoes [35, 68, 69]. The genetic diversity of all Ae. albopictus populations revealed by coxI gene was higher than that of Ae. aegypti in the present research. High haplotype number and haplotype diversity indicated that the population was more complex and better able to resist the effects of environmental change [70]. Aedes albopictus is a native mosquito species in China, and its adaptive evolution with the local environment might be longer than that of Ae. aegypti. Small and isolated populations are generally susceptible to negative factors such as environmental change, inbreeding and genetic randomness, which can reduce individual fitness and population viability, leading to reduced genetic diversity [71,72,73]. On Hainan Island and the Leizhou Peninsula, Ae. aegypti belongs to these small and range-restricted groups compared to Ae. albopictus. The population genetic results of this study reveal that Ae. aegypti populations with restricted range are less genetically diverse than widely distributed Ae. albopictus populations. Therefore, the elimination of breeding sites and the prevention of Ae. aegypti invasion should be continued to maintain the low genetic diversity of Ae. aegypti populations and to facilitate the complete elimination of Ae. aegypti from Hainan Island and the Leizhou Peninsula in the future.
Haplotype distribution
The haplotype diversity of all populations of Ae. albopictus was higher than that of Ae. aegypti. There were three predominant haplotypes (Hap_4, Hap_18 and Hap_26) in Ae. albopictus populations on Hainan Island and the Leizhou Peninsula, which were also found in other areas of China [25, 28, 74]. However, only one predominant haplotype was recorded in Ae. aegypti populations, from which the other 22 haplotypes evolved. High haplotype diversity and low nucleotide diversity were recorded in all the Aedes populations except the YGH population of Ae. aegypti, which may indicate rapid population growth after a bottleneck period and may have been caused by the widespread use of pesticides and the impact of human activities [25, 75]. The YGH population of Ae. aegypti exhibited low haplotype diversity and a low nucleotide diversity model and may have undergone founder events in which a new population was established by a small number of individuals drawn from a large ancestral population; the results of the UPGMA, DAPC and STRUCTURE analysis seemed to support this view (Fig. 2) [35, 76].
Population differentiation and genetic structure
Significant differentiation was found between all the Ae. aegypti populations, indicating less gene flow between populations and ultimately leading to a significant positive correlation between genetic distance and geographical distance [28, 32]. The degree of genetic differentiation varied between different populations of Ae. albopictus, with the WS population showing relatively high differentiation from other populations (Additional file 6: Table S6).
The results of both UPGMA and DAPC analysis supported the division of Ae. aegypti into three genetic clusters and Ae. albopictus into two, with the same population composition within each major genetic branch. Figure 2A, B shows that the YGH and WS populations of Ae. aegypti were genetically distant from the other three populations and formed two separate genetic clusters. The HT, HW and BS populations were genetically closer and formed a separate genetic cluster, which was also consistent with the geographical distance between the populations. Therefore, the genetic distance of Ae. aegypti populations was significantly and positively correlated with the geographic distance. Figure 2D, E shows that the Ae. albopictus population could be divided into two genetic clusters, with the WS population being genetically distant from the other four populations and forming a separate cluster. The YGH, HW, HT and BS populations formed one other large genetic cluster. The WS Ae. albopictus population was genetically distant from the other four populations, probably because the WS population was breeding on the Leizhou Peninsula, which was separated from the other four populations on Hainan Island by the Qiongzhou Strait and was the most geographically distant, so there was less gene flow with the other four populations, resulting in significant genetic differences.
Population expansion pattern
In the present study, only the HW population of Ae. aegypti showed a significant negative Tajima’s D value, which is used to detect neutral deviation caused by population bottleneck, expansion, directed selection or infiltration [77]. The result may indicate a historical expansion of the HW population of Ae. aegypti. The YGH, HT and HW populations of Ae. albopictus may experience historical population expansion events based on the Fu's Fs values, which can be used to detect historical fluctuations in population size, and the value was more sensitive [78]. The result was consistent with the mismatch distribution (Fig. 4). The other two populations, BS and WS, had negative Tajima’s D and Fu’s F values, but these were not significant, suggesting that the expansion may have been restricted to separate local areas [79].
All the populations of the two Aedes species deviated significantly from HWE. Most showed a He > Ho result, except for the BS population of Ae. albopictus, indicating a deficit in heterozygosity, which may have been caused by environmental selective pressure [27, 80, 81]. The TPM model was considered the best fit to the microsatellite data, and the results indicated that the BS population of Ae. aegypti experienced a bottleneck, which may have been related to environmental changes and the competition from Ae. albopictus. Over the past 2 years, new ports have been built in Basuo, resulting in the destruction of Ae. aegypti's breeding habitat and a sharp decline in species' numbers. At the same time, the local Ae. albopictus population has continued to invade its breeding sites, resulting in competition for space between the two species and ultimately leading to the decline of the Ae. aegypti population.
The Mantel test showed a significant positive correlation between genetic distance and geographic distance for the Ae. aegypti populations, but the correlation was not significant for Ae. albopictus populations, suggesting frequent gene flow between Ae. albopictus populations. This may be related to the rapid spread of these populations due to human activities, particularly the shipping trade [28]. Hainan Island has many trading ports in China, with cargo throughput reaching 199 million tons in 2020 [82]. The Qiongzhou Strait is an important transport link between Hainan Island and the Leizhou Peninsula, which is the only convenient gateway for maritime cargo between Hainan Island and the mainland. Frequent cargo trade inevitably leads to the continuous dispersal and gene exchange among Ae. albopictus populations in these areas.
Conclusions
The present study assessed the genetic diversity of Ae. aegypti and Ae. albopictus from cohabiting fields on Hainan Island and the Leizhou Peninsula in China and, for the first time to our knowledge, explained the reasons for the sharp decline in Ae. aegypti populations on Hainan Island and the Leizhou Peninsula in terms of population genetics. The results suggested that the population diversity of Ae. albopictus was greater than that of Ae. aegypti and that Ae. albopictus had invaded Ae. aegypti breeding sites in some places and continued to spread on these islands. The active dispersal of Ae. aegypti was smaller than that of other mosquitoes, including the continuous niche invasion of Ae. albopictus, which may inevitably lead to the decline in the population numbers and genetic diversity of Ae. aegypti. Genetic diversity is used to measure the ability of a species to adapt to environmental change and to predict the direction of its future survival and development as well as to explore when and how it arose and to speculate on routes of migration and dispersal. Low genetic diversity in Ae. aegypti populations may indicate a decline in the mosquito's ability to adapt environmental changes. Therefore, the Ae. aegypti population is more likely to be controlled on Hainan Island and Leizhou Peninsula. In terms of future vector control, the most critical and effective measure is to control the spread of Ae. albopictus and monitor the population genetic dynamics of Ae. aegypti, which could theoretically support the further elimination of Ae. aegypti in Hainan Island and Leizhou Peninsula, China.
Availability of data and materials
The raw data supporting the conclusions of this article will be made available by the authors without undue reservation.
Abbreviations
- coxI :
-
Mitochondrial cytochrome c oxidase subunit 1
- PIC:
-
Polymorphism information content
- SI:
-
Shannon’s diversity index
- H:
-
Number of haplotypes
- Hd:
-
Haplotype diversity
- UPGMA:
-
Unweighted pair-group method with arithmetic averaging nucleotide diversity
- DAPC:
-
Discriminant analysis of principal components
- SSR:
-
Simple sequence repeats
- LRM:
-
Lynch and Ritland estimator-mean
- Na:
-
Observed number of alleles
- Ne:
-
Effective number of alleles
- Ho:
-
Observed heterozygosity
- He:
-
Excepted heterozygosity
- HWE:
-
Hardy–Weinberg equilibrium
- LD:
-
Linkage disequilibrium
- TPM:
-
Two-phased mutation model
- AMOVA:
-
Analysis of molecular variation
- Fst:
-
Genetic differences among populations
- Nm:
-
Number of migrants
References
Gómez M, Martinez D, Muñoz M, Ramírez JD. Aedes aegypti and Ae. albopictus microbiome/virome: new strategies for controlling arboviral transmission? Parasit Vectors. 2022;15:287.
Duong CV, Kang JH, Nguyen VV, Bae YJ. Invasion pattern of Aedes aegypti in the native range of Ae. albopictus in Vietnam revealed by biogeographic and population genetic analysis. Insects. 2022;13:1079.
Shi QM, Zhang HD, Wang G, Guo XX, Xing D, Dong YD, et al. The genetic diversity and population structure of domestic Aedes aegypti (Diptera: Culicidae) in Yunnan Province, southwestern China. Parasit Vectors. 2017;10:292.
Benedict MQ, Levine RS, Hawley WA, Lounibos LP. Spread of the tiger: global risk of invasion by the mosquito Aedes albopictus. Vector Borne Zoonot Dis. 2007;7:76–85.
Caminade C, Medlock JM, Ducheyne E, McIntyre KM, Leach S, Baylis M, et al. Suitability of European climate for the Asian tiger mosquito Aedes albopictus: recent trends and future scenarios. J R Soc Interface. 2012;9:2708–17.
Lu BL. Dengue vector and dengue control in China. Guizhou: Guizhou People’s Publishing House; 1990.
Lin KS. The distribution and control of Ae. S. aegypti Linnaeus in Zhanjiang areas. Chin J Front Health Quar. 1996;19:336–8.
Liu LP, Duan JH, Lin LF, Cai SW, Yin WX, Yi JR, et al. Laboratory study on interspecific competition between Aedes albopictus and Aedes aegypti. Chin J Vector Biol Control. 2004;15:264–5.
Chen ZJ, Qin B, Bai AY, Wu J, Deng H, Duan JH, et al. An experimental study of interspecific competition between Aedes aegypti from Wushi town of Leizhou and Ae. albopictus from different places in Guangdong province, China. Chin J Vector Biol Control. 2020;31:486–9.
Li Y, Zhou G, Zhong S, Wang X, Zhong D, Hemming-Schroeder E, et al. Spatial heterogeneity and temporal dynamics of mosquito population density and community structure in Hainan Island, China. Parasit Vectors. 2020;13:444.
Huang JR, Li JL, Wang SS, Wu N, Wang SS, Tang GS, et al. Study on Aedes aegypti eradication in Guangxi. Guangxi Prev Med. 2005;11:3.
Tan Y, Feng XY, Jiang JH. Analysis on the dengue vector surveillance results during 2002–2003 in Guangxi. Chin J Hyg Insect Equip. 2004;10:154–6.
Juliano SA, Lounibos LP. Ecology of invasive mosquitoes: effects on resident species and on human health. Ecol Lett. 2005;8:558–74.
Tripet F, Lounibos LP, Robbins D, Moran J, Nishimura N, Blosser EM. Competitive reduction by satyrization? Evidence for interspecific mating in nature and asymmetric reproductive competition between invasive mosquito vectors. Am J Trop Med Hyg. 2011;85:265–70.
Feitoza TS, Ferreira-de-Lima VH, Câmara DCP, Honório NA, Lounibos LP, Lima-Camara TN. Interspecific mating effects on locomotor activity rhythms and refractoriness of Aedes albopictus (Diptera: Culicidae) females. Insects. 2020;11:874.
Zhou JY, Liu S, Liu HK, Xie ZS, Liu LP, Lin LF, et al. Interspecific mating bias may drive Aedes albopictus displacement of Aedes aegypti during its range expansion. PNAS Nexus. 2022;1:pgac041.
Lounibos LP, Juliano SA. Where vectors collide: The importance of mechanisms shaping the realized niche for modeling ranges of invasive Aedes mosquitoes. Biol Invasions. 2018;20:1913–29.
Steffler LM, Dolabella SS, Ribolla PE, Dreyer CS, Araújo ED, Oliveira RG, et al. Genetic variability and spatial distribution in small geographic scale of Aedes aegypti (Diptera: Culicidae) under different climatic conditions in Northeastern Brazil. Parasit Vectors. 2016;9:530.
Escobar D, Ortiz B, Urrutia O, Fontecha G. Genetic diversity among four populations of Aedes aegypti (Diptera: Culicidae) from Honduras as revealed by mitochondrial DNA cytochrome oxidase I. Pathogens. 2022;11:620.
Liu PB, Lu L, Jiang JY, Guo YH, Yang MD, Liu QY. The expanding pattern of Aedes aegypti in southern Yunnan, China: insights from microsatellite and mitochondrial DNA markers. Parasit Vectors. 2019;12:561.
Lv RC, Zhu CQ, Wang CH, Ai LL, Lv H, Zhang B, et al. Genetic diversity and population structure of Aedes aegypti after massive vector control for dengue fever prevention in Yunnan border areas. Sci Rep. 2020;10:12731.
Zheng YT, Jiang JY, Zhou HN, Ma YJ. Analysis of Aedes aegypti population genetic characteristics in key areas of dengue fever in Yunnan Province by ssr markers. Chin J Zoonoses. 2021;37:176–82.
Wang G, Gao J, Ma Z, Liu Y, Wang M, Xing D, et al. Population genetic characteristics of Aedes aegypti in 2019 and 2020 under the distinct circumstances of dengue outbreak and the COVID-19 pandemic in Yunnan Province. China Front Genet. 2023;14:1107893.
Zhang RL, Leng PE, Wang XJ, Zhang Z. Molecular analysis and genetic diversity of Aedes albopictus (Diptera, Culicidae) from China. Mitochondrial DNA A DNA Mapp Seq Anal. 2018;29:594–9.
Zhang RL, Yao GQ, Pan XQ, Ma DZ, Zhao AH, Zhang Z. Genetic diversities of different geographical populations of Aedes albopictus based on mitochondrial gene COI. Chin J Zoonoses. 2017;33:316–20.
Guo YY, Song ZY, Luo L, Wang QM, Zhou GF, Yang DZ, et al. Molecular evidence for new sympatric cryptic species of Aedes albopictus (Diptera: Culicidae) in China: a new threat from Aedes albopictus subgroup? Parasit Vectors. 2018;11:228.
Wei Y, Wang JT, Song ZY, He YL, Zheng ZH, Fan PY, et al. Patterns of spatial genetic structures in Aedes albopictus (Diptera: Culicidae) populations in China. Parasit Vectors. 2019;12:552.
Gao J, Zhang HD, Guo XX, Xing D, Dong YD, Lan CJ, et al. Dispersal patterns and population genetic structure of Aedes albopictus (Diptera: Culicidae) in three different climatic regions of China. Parasit Vectors. 2021;14:12.
Wei Y, He S, Wang JT, Fan PY, He YL, Hu K, et al. Genome-wide SNPs reveal novel patterns of spatial genetic structure in Aedes albopictus (Diptera Culicidae) population in China. Front Public Health. 2022;10:1028026.
Fang YL, Zhang SY, Xie HG, Lin Y, Lin YY, Yang FZ, et al. Study on mtDNA-COI genetic characteristics of Aedes albopictus in different geographic strains. Strain J Prev Med. 2011;17:1–4.
Guo S, Ling F, Wang JN, Wu YY, Hou J, Gong ZY. Genetic polymorphism analysis of cytochrome C oxidase subunit I gene in Aedes albopictus from Zhejiang Province, China. Chin J Zoonoses. 2016;32:133–6.
Zheng ZH, Wu SS, Wei Y, Zhong DB, Zheng XL. Analysis of the genetic diversity of 15 Aedes albopictus populations in Guangzhou based on the mitochondrial COI gene. Chin J Zoonoses. 2021;37:985–94.
Li ZB, Hou QH, Duan DY. Haplotypes diversity, genetic differentiation and phylogenetic analysis of Aedes albopictus. China Anim Husb Vet Med. 2023;50:1452–60.
Zhang HD, Gao J, Li CX, Ma Z, Liu Y, Wang G, et al. Genetic diversity and population genetic structure of Aedes albopictus in the Yangtze River basin, China. Genes (Basel). 2022;13:1950.
Md Naim D, Kamal NZM, Mahboob S. Population structure and genetic diversity of Aedes aegypti and Aedes albopictus in Penang as revealed by mitochondrial DNA cytochrome oxidase I. Saudi J Biol Sci. 2020;27:953–67.
Wilson-Bahun TA, Kamgang B, Lenga A, Wondji CS. Larval ecology and infestation indices of two major arbovirus vectors, Aedes aegypti and Aedes albopictus (Diptera: Culicidae), in Brazzaville, the capital city of the Republic of the Congo. Parasit Vectors. 2020;13:492.
Slotman MA, Kelly NB, Harrington LC, Kitthawee S, Jones JW, Scott TW, et al. Polymorphic microsatellite markers for studies of Aedes aegypti (diptera: culicidae), the vector of dengue and yellow fever. Mol Ecol Notes. 2007;7:168–71.
Lynch M, Ritland K. Estimation of pairwise relatedness with molecular markers. Genetics. 1999;152:1753–66.
Peakall R, Smouse PE. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research–an update. Bioinformatics. 2012;28:2537–9.
Jombart T. Adegenet: a R package for the multivariate analysis of genetic markers. Bioinformatics. 2008;24:1403–5.
Pritchard JK, Stephens M, Donnelly P. Inference of population structure using multilocus genotype data. Genetics. 2000;155:945–59.
Evanno G, Regnaut S, Goudet J. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol Ecol. 2005;14:2611–20.
Jakobsson M, Rosenberg NA. CLUMPP: a cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics. 2007;23:1801–6.
Rosenberg NA. Distruct: a program for the graphical display of population structure. Mol Ecol Notes. 2004;4:137–8.
Shaibi T, Lattorff H, Moritz R. A microsatellite DNA toolkit for studying population structure in Apis mellifera. Mol Ecol Resour. 2008;8:1034–6.
Raymond M, Rousset F. GENEPOP (Version 1.2): Population genetics software for Exact tests and ecumenicism. J Hered. 1995;68:248–9.
Cristescu R, Sherwin WB, Handasyde K, Cahill V, Cooper DW. Detecting bottlenecks using bottleneck 1.2.02 in wild populations: the importance of the microsatellite structure. Conserv Genet. 2010;11:1043–9.
Chris S, Francesco F, Andrew B, Bernie C, Hong L, Paul F. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Entomol Soc Am. 1994;87:651–701.
Zhong DB, Lo E, Hu RJ, Metzger ME, Cummings R, Bonizzoni M, et al. Genetic analysis of invasive Aedes albopictus populations in Los Angeles County, California and its potential public health impact. PLoS ONE. 2013;8:e68586.
Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33:1870–4.
Rozas J, Sánchez-DelBarrio JC, Messeguer X, Rozas R. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics. 2003;19:2496–7.
Clement M, Posada D, Crandall KA. TCS: a computer program to estimate gene genealogies. Mol Ecol. 2000;9:1657–9.
Excoffier L, Lischer HE. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour. 2010;10:564–7.
Wang YY, Lu BL, Wu ZQ, Gan BJ, Chen WW, Wu RX. Study on Aedes aegypti’s comprehensive control in Hainan Island. Chin J Vector Biol Control. 1996;7:161–5.
Cai CL, Wang AM, Xu BF, Lin JX, Chen JC. Investigation of distribution, ecological status, density and seasonal growth- decline of Aegypti in Leizhou Peninsula. Chin Front Health Quar. 2007;30:361–4.
Chen ZJ, Xing F, Zhang LJ, Deng H, Zhou JY, Huang JY, et al. Investigation of distribution of Aedes aegypti and Ae. Albopictus in Leizhou, Guangdong province. Chin J Vector Biol Control. 2018;29:46–9.
Artigas P, Reguera-Gomez M, Valero MA, Osca D, da Silva PR, Rosa-Freitas MG, et al. Aedes albopictus diversity and relationships in south-western Europe and Brazil by rDNA/mtDNA and phenotypic analyses: ITS-2, a useful marker for spread studies. Parasit Vectors. 2021;14:333.
Brookfield JF. A simple new method for estimating null allele frequency from heterozygote deficiency. Mol Ecol. 1996;5:453–5.
Chapuis MP, Estoup A. Microsatellite null alleles and estimation of population differentiation. Mol Biol Evol. 2007;24:621–31.
Dakin EE, Avise JC. Microsatellite null alleles in parentage analysis. Heredity (Edinb). 2004;93:504–9.
Yuan Y, Li Q, Kong LF, Yu H. The complete mitochondrial genome of the grand jackknife clam, Solen grandis (Bivalvia: Solenidae): a novel gene order and unusual non-coding region. Mol Biol Rep. 2012;39:1287–92.
Su AF, Pei ZC, Fu JC, Li JG, Feng F, Zhu Q, et al. Analysis of distribution and population density changes of Aedes egypti the transmission vector of dengue fever in Haikou City. China Trop Med. 2005;5:1394–5.
Wang ZG, Wang SQ, Masaji O, Takagi M, Tsuda Y, Zeng LH, et al. Investigation on Ae. aegypti and Ae. albopictus in the north-western part of Hainan Province. China Trop Med. 2005;5:230–3.
Xie H, Zhou HN, Yang YM. Advances in the research on the primary dengue vector Aedes aegypti in China. Chin J Vector Biol Control. 2011;22:194–7.
Saarman NP, Gloria-Soria A, Anderson EC, Evans BR, Pless E, Cosme LV, et al. Effective population sizes of a major vector of human diseases, Aedes aegypti. Evol Appl. 2017;10:1031–9.
Powell W, Morgante M, Andre C, Hanafey M, Vogel J, Tingey S, et al. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol Breed. 1996;2:225–38.
Goldstein DB, Pollock DD. Launching microsatellites: a review of mutation processes and methods of phylogenetic interference. J Hered. 1997;88:335–42.
Fang YL, Zhang JQ, Wu RQ, Xue BH, Qian QQ, Gao B. Genetic polymorphism study on Aedes albopictus of different geographical regions based on DNA barcoding. Biomed Res Int. 2018;2018:1501430.
Salgueiro P, Serrano C, Gomes B, Alves J, Sousa CA, Abecasis A, et al. Phylogeography and invasion history of Aedes aegypti, the Dengue and Zika mosquito vector in Cape Verde islands (West Africa). Evol Appl. 2019;12:1797–811.
Song SX, Ding SX, Wu QP, Qin YX. Genetic diversity of six geographic populations of Sipunculus nudus in the coasts of China. J Fish China. 2017;41:1183–91.
Kaljund K, Jaaska V. No loss of genetic diversity in small and isolated populations of Medicago sativa subsp. falcata. Biochem Syst Ecol. 2010;38:510–20.
Hudson MA, Young RP, D’Urban Jackson J, Orozco-terWengel P, Martin L, James A, et al. Dynamics and genetics of a disease-driven species decline to near extinction: lessons for conservation. Sci Rep. 2016;6:30772.
Li S, Li B, Cheng C, Xiong Z, Liu Q, Lai J, et al. Genomic signatures of near-extinction and rebirth of the crested ibis and other endangered bird species. Genome Biol. 2014;15:557.
You LB, Li YW, Wang JZ, Kan NP, Zhang YJ. Phylogenetic analysis of cytochrome C oxidase subunit I genes in Aedes albopictus in Fujian Province. China J Parasit Biol. 2019;14:521–4.
Rogers AR, Harpending H. Population growth makes waves in the distribution of pairwise genetic differences. Mol Biol Evol. 1992;9:552–69.
Templeton AR. The reality and importance of founder speciation in evolution. BioEssays. 2008;30:470–9.
Tajima F. The effect of change in population size on DNA polymorphism. Genetics. 1989;123:597–601.
Ramos-Onsins SE, Rozas J. Statistical properties of new neutrality tests against population growth. Mol Biol Evol. 2002;19:2092–100.
Liao PC, Kuo DC, Lin CC, Ho KC, Lin TP, Hwang SY. Historical spatial range expansion and a very recent bottleneck of Cinnamomum kanehirae Hay (Lauraceae) in Taiwan inferred from nuclear genes. BMC Evol Biol. 2010;10:124.
Weir BS, Cockerham CC. Estimating f-statistics for the analysis of population structure. Evolution. 1984;38:1358–70.
Takezaki N, Nei M. Genetic distances and reconstruction of phylogenetic trees from microsatellite DNA. Genetics. 1996;144:389–99.
Fang Z, Zong HM, Hu Y, Xu X. Study on the characteristics and layout development of Hainan’s ports based on cluster analysis. China Water Transport. 2022;9:18–20.
Acknowledgements
We thank all the participants. We are also grateful to the members of the Jiangxi International Healthcare Center for their support and assistance in the research.
Funding
This work was funded by grants from the Infective Diseases Prevention and Cure Project of China (No. 2017ZX10303404).
Author information
Authors and Affiliations
Contributions
TYZ, HDZ and MHZ designed the study; MHZ, XR and XYJ participated in sample collection; MHZ, XR, YB and YL carried out the laboratory work; MHZ, TYZ and HDZ conducted the statistical analysis; TYZ, CXL, DX, XXG, WL and KC coordinated the research; MHZ, HDZ, ZM and JG visualized the data; All authors have read and agreed to the published version of the manuscript.
Corresponding authors
Ethics declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Additional information
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Additional file 1: Table S1.
Details on nine pairs and 11 pairs microsatellite loci of Aedes aegypti and Ae. albopictus, respectively.
Additional file 2: Table S2.
Genetic relatedness in Aedes aegypti and Ae. albopictus populations by LRM.
Additional file 3: Table S3.
Hardy-Weinberg equilibrium (HWE) based on nine microsatellite loci for Aedes aegypti and the 11 microsatellite loci for Ae. albopictus.
Additional file 4: Table S4.
AMOVA based on different molecular markers for Aedes aegypti and Ae. albopictus.
Additional file 5: Table S5.
Neutrality test for Aedes aegypti and Ae. albopictus based on coxI gene.
Additional file 6: Table S6.
Fst and Nm matrix calculated for Aedes aegypti and Ae. albopictus based on coxI gene (Fst values below the diagonal and Nm (Nm = (1/Fst-1)/4) above the diagonal for every diagonal; bold numbers indicate significance at P < 0.05).
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Zhao, M., Ran, X., Bai, Y. et al. Genetic diversity of Aedes aegypti and Aedes albopictus from cohabiting fields in Hainan Island and the Leizhou Peninsula, China. Parasites Vectors 16, 319 (2023). https://doi.org/10.1186/s13071-023-05936-5
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s13071-023-05936-5
Keywords
- Aedes aegypti
- Aedes albopictus
- Genetic diversity
- Microsatellite DNA
- coxI