Open Access

Eco-epidemiology of porcine trypanosomosis in Karim Lamido, Nigeria: prevalence, seasonal distribution, tsetse density and infection rates

Parasites & Vectors20169:448

https://doi.org/10.1186/s13071-016-1732-x

Received: 7 May 2016

Accepted: 27 July 2016

Published: 12 August 2016

Abstract

Background

Animal trypanosomosis is a major economic disease in Nigeria causing considerable morbidity and mortality in livestock. Despite reports in other animals, the disease is under reported in pigs.

Methods

We conducted a community based epidemiological study on African animal trypanosomosis in Karim Lamido area of Taraba State, Nigeria using species-specific PCR on 712 pigs and 706 of the 2822 captured tsetse flies. Data were analysed using Chi-square, odds ratio and multivariate analysis at 95 % confidence interval.

Results

Overall prevalence of porcine trypanosomosis was 16.6 % and ranged between 2.0 and 8.8 % across Trypanosoma species. Seasonal distribution of porcine trypanosomosis varied significantly (χ 2 = 16.62, df = 3, P = 0.0008) ranging between 7.9 and 23.6 % across seasons. Mixed infections involving T. b. brucei, T. congolense forest and T. congolense savannah recorded infection rates ranging between 2.5 and 9.3 %. There were significant variations between the trypanosome infection rates in relation to age (χ 2 = 7.629, df = 1, P = 0.0057, OR = 1.932, 95 % CI = 1.203–3.100), sex (χ 2 = 10.09, df = 1, P = 0.0015, OR = 2.085, 95 % CI = 1.315–3.304) and body condition (χ 2 = 22.10, df = 2, P < 0.0001) of pigs ranging between 10.4 and 30.3 %. Tsetse infection rates were 11.2 % (79/706) for Glossina palpalis and 6.8 % (48/706) for G. tachinoides yielding an overall infection rate of 18.0 %.

Conclusion

Trypanosoma species are prevalent in the study area with similar distribution patterns in both pigs and tsetse flies. Late rainy season, adults, females and pigs with poor body condition recorded higher trypanosome infection rates. Of the three Trypanosoma spp. identified, T. b. brucei showed predominance.

Keywords

Eco-epidemiology Prevalence of porcine trypanosomosis Seasonal distribution Tsetse density and infection rates Species-specific PCR

Background

Trypanosomoses refer to a group of vector-borne parasitic diseases caused by protozoa of the genus Trypanosoma. Trypanosoma brucei brucei¸ T. congolense, T. vivax, T. evansi, T. simiae are all infective to animals causing African animal trypanosomosis while T. brucei gambiense and T. brucei rhodesiense are the only species pathogenic to man in Africa. Transmission is usually cyclical through bites of infected flies of the genus Glossina; however, mechanical transmission is possible by other haematophagous flies of the genera Hamatopota, Tabanus and Stomoxys.

Tsetse-transmitted trypanosomoses occur in 38 sub-Saharan African countries with less than 10,000 human cases and one million cattle deaths reported yearly, exposing over 70 million people and 160 million cattle to the risk of infection in the region [1]. The disease is distributed over a wide range of habitats covering about 10 million square kilometres of potential grazing and farming lands in sub-Saharan Africa [2]. It is one of the major factors militating against the development of livestock industry in Nigeria. Substantive evidence shows that, 21 of the 38 countries endemic for trypanosomosis were grouped among the 25 poorest countries of the world indicating the role of the disease in Africa’s struggle against poverty [3].

In Nigeria, tsetse-transmitted trypanosomosis is endemic in over 80 % of the 928,300 km2 land-mass and follows the pattern of tsetse distribution covering the area between latitudes 4° and 13°N of the country including the highlands of Jos, Mambilla and Obudu which were earlier considered tsetse- and trypanosomosis-free [4]. The most important Trypanosoma species in Nigeria are Trypanosoma brucei brucei, T. congolense, T. vivax and T. evansi in animals as well as T. brucei gambiense which is infective to humans [5]. Economic losses caused by these parasites as a result of mortality, loss in productivity, costs of treatment and other control programmes were estimated at over 4.2 million USD annually [5].

Despite efforts to eradicate poverty through livestock production, several factors including trypanosomosis are still militating against the livestock sector in Nigeria. Trypanosomosis is well documented in Nigeria in cattle [68], small ruminants [911] and camels [12, 13]. However, there is paucity of information on porcine trypanosomosis despite the role of this animal species in the economy of the nation. In this study, we determined the prevalence of porcine trypanosomosis, tsetse density and infection rates in Karim Lamido, Nigeria.

Methods

Study area

This study was carried out in Karim Lamido Local Government Area of Taraba State which is located in North-eastern Nigeria between latitudes 8°33′–10°21′N and longitudes 10°21′–11°24′E (Fig. 1). It covers a land mass of 6,620 km2 with a population of 195,844 and a sub-Sudan vegetation. It is bounded to the south by the River Benue and traversed by several tributaries of the same river. It has two distinct seasons namely; rainy which extends from May to October and dry which extends from November to April with an average annual precipitation of 1058 mm and annual average temperature of 28 °C. The major agricultural activities in the region include crop farming, livestock production and fishing. Karim Lamido is a centre for pig trade and pigs are bred under intensive, semi-intensive and extensive management systems.
Fig. 1

Map of Nigeria showing Taraba State, Karim Lamido and the study sites

Study design

We conducted a community-based cross-sectional study of porcine trypanosomosis between December, 2013 and September, 2014 in five villages (Binari, Gen, Jevjev, Karim and Mutum Daya) located at radii of at least 5 to 10 km apart. For the purpose of our study, we divided the year into four seasons namely; late dry (February - April), early rainy (May - July), late rainy (August - October) and early dry (November - January) and a total of 712 pigs were sampled across this period. We identified and randomly selected 35 piggeries which were considered as clusters from which individual pigs were selected using simple balloting. These clusters were also sub-divided into sub-units (strata) based on age, body condition and sex of pigs. We also sampled 30 % or 50 % of pigs from piggeries with sizes of ≥ 50 or < 50 pigs respectively taking into consideration strata such as age, sex, season and body condition of pigs. Body condition scores were estimated based on the prominence or absence of protrusion of the bones of the ribs, pin-bone and spinous processes of the backbone in to thin (poor), borderline (intermediate) and optimum (good) as earlier described [14].

Tsetse flies were trapped using twelve biconical traps mounted 120 m apart, thrice a week during December, 2013, March, June, and September, 2014. Trypanosome infection rates in both pigs and tsetse flies were estimated at 95 % confidence intervals.

Blood sampling of pigs and purification of trypanosomes

Five ml of blood was aseptically collected from each pig via venopuncture and transferred immediately into clean labelled sample bottles containing ethylene diamine tetra-acetic acid (EDTA) at 1.5 mg/ml [15, 16]. This was gently shaken until the blood was properly mixed with the anticoagulant.

The trypanosomes isolated from pig blood were separated from the blood using a DEAE 52 column (Whatman, Maidstone, Kent, UK) as described by [17] and stored at 4 °C in phosphate saline glucose (PSG) buffer until needed for DNA extraction.

Entomological studies

Tsetse flies were trapped by the use of biconical traps as described by [18]. Traps were emptied every 24 h and flies were identified using morphological characteristics as described by [19]. Following identification, one fourth of the total catch which was randomly selected across seasons and locations were stored at -80 °C and later subjected to species specific PCR for the identification of vector stages of trypanosomes.

Genomic DNA extractions

Trypanosome DNA was extracted from pig blood and tsetse flies using GeneJET genomic DNA extraction kit (Thermo Scientific, Germany). Briefly, 200 μl of purified trypanosomes was lysed by adding 400 μl of lysis solution and 20 μl of proteinase K as recommended by the manufacturer. For extraction of genomic DNA from tsetse flies, the tsetse flies were first homogenized and further subjected to the DNA extraction protocol for trypanosomes as described above. Extracted DNA was stored at -20 °C until needed for PCR.

Molecular identification of trypanosomes

We conducted eight different PCRs namely Trypanosoma brucei (TBR), T. congolense forest (TCF), T. congolense kilifi (TCK), T. congolense savannah (TCS), West African T. vivax (WA-TV), T. evansi (TeRoTat), T. gambiense serum glycoprotein (TgsGP) and Serum resistant antigen (SRA) PCRs. All PCRs were carried out in 25 μl reaction mixture containing 1U Taq DNA Polymerase (Promega, USA), PCR buffer (Promega, USA), 2.5 mM MgCl2 (Promega, USA), 200 μM of each of the four dNTPs (Roche, Mannheim, Germany), 1.0 μl of primers in Table 1 and 5.0 μl of sample DNA. Amplifications were carried out using Gene Amp PCR system 9700 (Applied Biosystems, UK). Reaction conditions for the different PCRs were as shown in Table 2 and all amplified products were analyzed by electrophoresis in a 2 % agarose gel and UV illumination after ethidium bromide staining. DNAs extracted from different animal trypanosomes obtained at the National Institute for Trypanosomiasis Research, Jos, Nigeria, and human infective trypanosomes obtained at the Institute of Tropical Medicine, Antwerp, Belgium were used as positive controls while water was used as a negative control.
Table 1

Primer names, targets, sequences and amplicon sizes for PCR detection of African trypanosomes

Primer [Reference]

Target species

Target gene

Sequence (5'-3')

Amplicon size (bp)

TBR1 [44]

Trypanozoon

177 bp repeat

cgaatgaatattaaacaatgcgcagt

173

TBR2 [44]

 

Sequence

agaaccatttattagctttgttgc

 

TCK1 [45]

T. c. kilifi

SDNAm

gtgcccaaatttgaagtgat

294

TCK2 [45]

  

actcaaaatcgtgcacctcg

 

TCF1 [45]

T. c. forest

SDNAm

ggacacgccagaaggtactt

350

TCF2 [45]

  

gttctcgcaccaaatccaac

 

TCS1 [45]

T. c. savannah

SDNAm

cgagaacgggcactttgcga

316

TCS2 [45]

  

ggacaaagaaatcccgcaca

 

TVWI [46]

T. vivax

ILDat 1.2

gtgctccatgtgccacgttg

175

TVW2 [46]

  

catatggtctgggagcgggt

 

TeRoTat 920 F [47]

T. evansi

RoTat 1.2

ctgaagaggttggaaatggagaag

151

TeRoTat 1070R [47]

 

VSG gene

gtttcggtggttctgttgttgtta

 

TgsGP-F [48]

T. brucei

TgsGP

gctgctgtgttcggagagc

308

TgsGP-R [48]

gambiense

 

gccatcgtgcttgccgctc

 

SRA-F [49]

T. brucei

SRA

atagtgacaagatgcgtactcaacgc

284

SRA-R [49]

rhodesiense

 

aatgtgttcgagtacttcggtcacgct

 
Table 2

Reaction conditions for different polymerase chain reactions

PCR

PD Temp/time

No. of cycles

DTemp/time

Tm Temp/time

ETemp/time

FE Temp/time

TBR

94 °C, 3 min

35

94 °C, 30 s

55 °C, 1 min

72 °C, 1 min

72 °C, 5 min

TCF, TCK and TCS

94 °C, 3 min

35

94 °C, 1 min

60 °C, 2 min

72 °C, 1 min

72 °C, 5 min

WA-TV

94 °C, 1 min

35

94 °C, 30 s

55 °C, 1 min

72 °C, 2 min

72 °C, 5 min

TeRoTat

95 °C, 2 min

35

95 °C, 30 s

58 °C, 30 s

72 °C, 1 min

72 °C, 5 min

TgsGP and SRA

95 °C, 15 min

45

95 °C, 1 min

63 °C, 1 min

72 °C, 1 min

72 °C, 5 min

Abbreviations: PD (Pre-denaturation), D (denaturation), Tm (annealing temperature), E (extension), FE (final extension), Temp (temperature)

Data analysis

Data collated were analyzed using Statistical Package for Social Sciences (SPSS 20.0) and Graph-Pad Prism 4.0. Trypanosome infection rates in pigs were calculated by dividing the number of pigs positive for trypanosomes by the total number of pigs examined and expressed as percentages. Tsetse infection rates were calculated by dividing the number of infected tsetse flies by the total number of flies analysed and expressed as percentages. Average tsetse catch per day was determined by summing the daily catch per week and dividing by the number of days traps were mounted for the week while average catch per trap was determined by summing daily catch and dividing by the number of traps. The Chi-square (χ 2) test and odds ratio were employed where appropriate to determine statistical associations between prevalence rates of different variables examined. We also employed multivariate analysis to determine variations in the seasonal distributions of porcine trypanosomosis and tsetse infection rates at 95 % confidence interval and values of P < 0.05 were considered significant.

Results

We analysed a total of 712 pig blood samples across seasons, 178 each during the early dry (December), late dry (March), early rainy (June) and late rainy (September) seasons. A total of 118 pigs were positive for Trypanosoma species yielding an overall trypanosome infection rate of 16.6 %, of which 8.8 % (63/712), 2.0 % (14/712), 2.7 % (19/712) and 3.1 % (22/712) were T. brucei brucei, T. congolense forest, T. congolense savannah and mixed infections, respectively (Fig. 2; Table 3). Seasonal distribution of swine trypanosomosis varied significantly (χ 2 = 16.62, df = 3, P = 0.0008) and were 16.3 % (29/178), 7.9 % (14/178), 18.5 % (33/178) and 23.6 % (42/178) for early dry, late dry, early rainy and late rainy seasons, respectively (Table 3). Of the 22 (18.6 %) mixed infections detected, 2.5, 6.8 and 9.3 % were due to T. b. brucei and T. congolense savannah, T. b. brucei and T. congolense forest as well as T.congolense forest and T. congolense savannah (Fig. 2).
Fig. 2

Distribution of Trypanosoma species among the 118 positive pigs. Abbreviations: TBB, T. b. brucei; TCF, T. congolense forest; TCS, T. congolense savannah; TBB + TCF, T. b. brucei and T. congolense forest mixed infections; TBB + TCS, T. b. brucei and T. congolense savannah mixed infections; TCF + TCS, T. congolense forest and T. congolense savannah mixed infections

Table 3

Seasonal distribution of porcine trypanosomosis in Karim Lamido

Season

Number examined

Number positive (%)

T. b. brucei (%)

T. congolense forest (%)

T. congolense savannah (%)

Mixed infections (%)

Early dry

178

29 (16.3)

15 (8.4)

4 (2.3)

6 (3.4)

3 (1.7)

Late dry

178

14 (7.9)

8 (4.5)

1 (0.6)

2 (1.1)

2 (1.1)

Early rainy

178

33 (18.5)

18 (10.1)

6 (3.4)

4 (2.3)

11 (6.2)

Late rainy

178

42 (23.6)

22 (12.4)

3 (1.7)

7 (3.9)

6 (3.4)

Total

712

118 (16.6)

63 (8.8)

14 (2.0)

19 (2.7)

22 (3.1)

Age (χ 2 = 7.629, df = 1, P = 0.0057, OR = 1.932, 95 % CI = 1.203–3.100) and sex (χ 2 = 10.09, df = 1, P = 0.0015, OR = 2.085, 95 % CI = 1.315–3.304) based trypanosome infection rates varied significantly and were 17.2 % (93/484), 15.4 % (25/228) 19.9 % (91/458) and 10.6 % (27/254) for adults, piglets, females and males, respectively (Table 4). There was also significant variation (χ 2 = 22.10, df = 2, P < 0.0001) between the infection rates of 15.1 % (63/417), 10.4 % (18/173) and 30.3 % (37/122) recorded by pigs with good, intermediate and poor body conditions, respectively (Table 5).
Table 4

Age and sex based prevalence of porcine trypanosomosis in Karim Lamido

Variable

Number examined (%)

Number positive

Prevalence (%)

P-value (χ 2)

Odds ratio (95 % CI)

Age

     

Adults (> 6 months)

484 (67.9)

93

17.2

0.0057

1.932

Piglets (≤ 6 months)

228 (32.1)

25

15.4

(7.629)

(1.203–3.100)

Total

712 (100)

118

16.6

  

Sex

     

Female

458 (64.3)

91

19.9

< 0.0001

 

Male

254 (35.7)

27

10.6

(10.09)

2.085

Total

712 (100)

118

16.6

 

(1.315–3.304)

Table 5

Prevalence of porcine trypanosomosis in relation to body condition of pigs

Body condition

Number examined (%)

Number positive

Prevalence (%)

P-value (χ 2)

Good

417 (58.6)

63

15.1

 

Intermediate

173 (24.3)

18

10.4

< 0.0001

Poor

122 (17.1)

37

30.3

(22.10)

Total

712 (100)

118

16.6

 
A total of 2822 tsetse flies were trapped within 4 months with overall apparent density of 4.9 tsetse flies per trap per day. Of the tsetse flies caught, 32 flies were found dead during collection from the traps and 28 were teneral flies (Table 6). None of the teneral tsetse flies were included among the 706 flies analysed for trypanosome identification. Apparent densities per seasons were 3.4, 3.9, 5.0 and 7.3 flies/trap/day for early dry, late dry, early rainy and late rainy season, respectively (Table 6). We subjected 706 (25.0 %) of the total tsetse flies caught to species-specific PCR for the presence of vector stages of trypanosomes. We obtained tsetse overall infection rate of 18.0 % (127/706), of which 11.2 % (79/706), 6.8 % (48/706) represented infection rates in Glossina palpalis and Glossina tachinoides, respectively (Table 7).
Table 6

Apparent densities and infection rates of tsetse flies per season

Season

Catch/trap/day

Total catch

No. of dead flies (%)

No. of teneral flies

No. of subjected to PCR

No. of infected (%)

GP (%)

GT (%)

Early dry

3.4

485

12 (2.5)

3 (0.6)

122

10 (8.2)

7 (5.7)

3 (2.5)

Late dry

3.9

568

7 (1.2)

5 (0.9)

142

18 (12.7)

6 (4.2)

12 (8.5)

Early rainy

5.0

713

6 (0.8)

9 (1.3)

178

37 (20.8)

23 (12.9)

14 (7.9)

Late rainy

7.3

1056

7 (0.7)

11 (1.0)

264

62 (23.5)

43 (16.3)

19 (7.2)

Total

4.9

2822

32 (1.1)

28 (1.0)

706

127 (18.0)

79 (11.2)

48 (6.8)

Abbreviations: GP, Glossina palpalis; GT, Glossina tachinoides

Table 7

Tsetse infection rates in relation to species of trypanosome

Tsetse species

No. trapped

No. subjected to PCR (%)

No. infected (%)

TBB (%)

TCF (%)

TCS (%)

MI (%)

G. palpalis

1772 (62.8)

451 (63.9)

82 (18.2)

41 (9.1)

23 (5.1)

12 (2.7)

7 (1.6)

G. tachinoides

1049 (37.2)

255 (36.1)

45 (17.7)

22 (8.6)

11 (4.3)

6 (2.4)

5 (2.0)

Total

2822 (100)

706 (100.0)

127 (18.0)

63 (8.9)

34 (4.8)

18 (2.6)

12 (1.7)

Abbreviations: TBB, Trypanosoma brucei brucei; TCF, T. congolence forest; TCS, T. congolense savannah; MI, mixed infections

Of the 127 tsetse flies positive for trypanosomes, 8.9 % (63/706), 4.8 % (34/706), 2.6 % (18/706) and 1.7 % (12/706) were due to T. b. brucei, T. congolense forest, T. congolense savannah and mixed infections, respectively (Table 7). The distribution of trypanosomes in G. palpalis were 9.1 % (41/451), 5.1 % (23/451), 2.7 % (12/451) and 1.6 % (7/451) for T. b. brucei, T. congolense forest, T. congolense savannah and mixed infections, respectively while those for G. tachinoides were 8.6 % (22/255), 4.3 % (11/255), 2.4 % (6/255) and 2.0 % (5/255), respectively (Table 7).

Discussion

To the best of our knowledge, this is the first time trypanosomes are characterised in this region using polymerase chain reaction. The findings of the present study are confirmation of the existence of Trypanosoma species including Trypanosoma brucei, T. congolense and T. vivax which were earlier reported in this region using conventional parasitological techniques [6, 20]. However, this is the first time a study will identify subspecies and types of trypanosomes like T. brucei brucei, T. congolense forest and T. congolense savannah which the conventional parasitological techniques were unable to identify.

Though our study targeted porcine trypanosomosis, we included primers for the detection of human-infective T. b. gambiense and T. b. rhodesiense to rule out their presence among all samples that were positive for T. brucei (sensu lato) using TBR-PCR, especially with recent reports that showed serological [2123] and molecular [21, 24, 25] evidence of animal reservoirs of human pathogenic trypanosomes. In order to rule out the presence of mechanically transmitted T. evansi among the trypanosomes detected in the pigs sampled, we used TeROTat-PCR. Substantive evidence also showed that certain strains of T. vivax do not commonly infect pigs [2628]. Considering the fact that the parasite is reported in and around the study area in ruminants [2931], their absence in pigs may suggest that the strains present in this region might not be infective to pigs.

We believe that factors including environmental conditions such as humidity and temperature as well as the migration of cattle, which may be another possible source of trypanosomes are associated with the occurrence of tsetse flies and animal trypanosomosis in the region we studied as earlier observed [7, 32]. The overall prevalence of 16.6 % observed in this study was higher than reports from earlier studies [6, 20] that utilized less sensitive diagnostic techniques around the same region. Our finding was, however, lower than the 40.0 and 46.8 % documented by Anosike et al. [33] and Majekodunmi et al. [7], respectively in Jos, Nigeria which was not surprising considering that the work of Anosike et al. [33] was conducted during an outbreak of trypanosomosis. Seasonal distributions of trypanosomes showed significant variations as earlier reported [7]. Rainy season provides ideal environmental conditions for tsetse movements and activity which in turn leads to the transmission of trypanosomosis. This may explain the higher trypanosome infection rates observed in pigs during the rainy season. Other factors which might have contributed to these seasonal variations may be differences in production systems which may include extensive, intensive and semi-intensive as well as environmental conditions including temperature, humidity, vegetation and human activity.

Our finding showed predominance of T. brucei brucei over T. congolense forest and savannah types in pigs contrary to earlier reports [7, 33] in cattle on the Jos Plateau which revealed predominance of T. congolense over T. b. brucei. This suggests that different hosts and vectors combine to support trypanosome population within the ecosystem. Although the majority of studies on animal trypanosomosis in Nigeria focused on cattle and small ruminants, T. brucei preference for pigs was earlier documented [27, 34]. The epidemiological implications of finding mixed infections in pigs is the risk of tsetse flies transmitting more than one trypanosome species from one infected host to another. This is particularly of concern, considering the varying response of Trypanosoma species to different trypanocides. Drug resistance, treatment failure and relapse arising from mixed infections of trypanosomes have also been documented [35].

We sampled 484 (67.9 %) adult pigs against 228 (32.1 %) piglets which did not give equal representation in the sampling because of the unwillingness of pig owners to allow access to the piglets due to their belief that the piglets will be harmed in the process of bleeding. Furthermore, because these pigs were kept for economic purposes, the majority of sampled animals were predominantly females. The higher prevalence observed in females may be due to the stress associated with hormonal imbalances during pregnancy and lactation which usually increases females’ susceptibility to infections.

The majority of the pigs sampled had good body condition; however, pigs with poor body conditions recorded higher prevalence rate which was not surprising since trypanosomosis may also present as chronic and wasting disease in animals and man. Trypanosoma b. brucei parasitaemia develops faster than T. congolense thus presenting faster effects which we believe is the possible explanation for their predominance among pigs with poor body conditions.

The tsetse fly species reported in this study were earlier reported in the same region [36], as well as other parts of Nigeria [32, 37, 38] and were among the first eleven species of tsetse flies reported in Nigeria [39]. Glossina palpalis was predominantly higher than G. tachinoides in line with earlier reports [38, 40, 41]. The predominance of Glossina palpalis may be associated with factors such as the availability of sources of animal blood meals, temperature, humidity, and other environmental conditions that promote their breeding. The aforementioned factors including the forested nature of the study area may also explain the low tsetse mortality rate observed. In addition, their low fecundity may be a possible explanation for the fewer number of teneral tsetse flies captured.

The study revealed an overall tsetse apparent density of 4.9 flies per trap per day which is slightly lower than the report of Dede et al. [32] who worked around the same periods of the year in Jos, Nigeria and is also within the range of 0.61–8.1 reported elsewhere [41, 42]. The finding of higher tsetse density during the rainy season is in line with the report of Desta et al. [43] in Ethiopia and may be associated to the favourable weather during the season which usually supports tsetse activity thus increasing vector-host contacts and possible transmission of trypanosomes.

This is not the first time that these species of trypanosomes (T. b. brucei and T. congolense) are reported in this region, suggesting their endemicity and the need to review tsetse control programmes in the region. The distributions of Trypanosoma species among domestic pigs and tsetse flies showed a similar pattern which was not surprising because these flies are responsible for the transmission of trypanosomes to the animal species in the region. The majority of trypanosome infections were observed among Glossina palpalis contrary to an earlier report [42]. This variation may be due to factors such as differences in feeding frequencies, feeding patterns and vectoral capacity of the tsetse flies. The mixed infections of Trypanosoma species observed in tsetse flies may be due to tsetse acquiring the infection from animals carrying the mixed infection in nature or from two different animal sources during feeding.

Conclusion

Trypanosoma species are prevalent in Karim Lamido with similar distribution patterns in both pigs and tsetse flies. Subspecies and types of trypanosomes like Trypanosoma brucei brucei, T. congolense forest and T. congolense savannah are reported for the first time in this region. Late rainy season, adults, females and pigs with poor body condition recorded higher trypanosome infection rates and T. b. brucei showed predominance of all the three Trypanosoma species identified. Glossina palpalis showed predominance over G. tachinoides and showed the highest infection rate. It is pertinent to improve on tsetse and trypanosomosis control strategies in the study area so as to curtail economic losses caused by this disease.

Abbreviations

CI, confidence interval; DEAE, di-ethyl-amino ethanol; df, degree of freedom; DNA, deoxyribonucleic acid; MgCl2, magnesium chloride; OR, odds ratio; PSG, phosphate saline glucose; SPSS, statistical package for social sciences, SRA, serum resistance antigen; TBR, Trypanosoma brucei; TCF, Trypanosoma congolense forest; TCK, Trypanosoma congolense kilifi; TCS, Trypanosoma congolense savannah; TgsGP, Trypanosoma gambiense serum glycoprotein; UV, ultra-violet; WA-TV, West African Trypanosoma vivax

Declarations

Acknowledgements

The authors are grateful to Prof Kabir Junaidu; the Director Biotechnology Centre, Ahmadu Bello University, Zaria, Nigeria and all other staff of the Centre for allowing us to use their facilities. We also wish to acknowledge Musa Sule and Emmanuel Dalyop for assisting in bleeding of pigs and trapping of tsetse flies.

Funding

Not applicable.

Availability of data and materials

The data supporting the conclusion of this article are all included within the article.

Authors’ contributions

SNK: Conceived and designed the study, SNK and IA: collected and analysed samples in the laboratory, SNK and GM; analysed data using statistics, SNK: wrote the paper. All authors read and approved the final version of the manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

This study was approved by the ethical committee of the Ahmadu Bello University Post-graduate School and observed all the guidelines governing the use of animals in research.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Veterinary Public Health and Preventive Medicine, University of Jos
(2)
Department of Veterinary Public Health and Preventive Medicine, Ahmadu Bello University
(3)
Department of Veterinary Surgery and Medicine, Ahmadu Bello University

References

  1. World Health Organization. Control and Surveillance of Human African Trypanosomiasis Report of a WHO Expert Committee WHO Technical Report Series 984. Geneva, Switzerland: World Health Organization; 2013.Google Scholar
  2. Kuzoe FAS. Current status of trypanosomiasis. Acta Trop. 1993;54(3&4):153–62.View ArticlePubMedGoogle Scholar
  3. Programme Against African Trypanosomiasis. PAAT - On target against poverty 1997–2007. Rome: PAAT, Food and Agriculture Organization of the United Nations; 2008.Google Scholar
  4. Onyiah JA. African Trypanosomiasis: An overview of the current status in Nigeria. Tropical Vet. 1997;15:111–6.Google Scholar
  5. Samdi SM, Abenga JN, Attahir A, Haruna MK, Wayo BM, Fajinmi AO, et al. Impact of trypanosomosis on food security in Nigeria: a review. Int J Animal Vet Adv. 2010;2(2):47–50.Google Scholar
  6. Karshima NS, Bobbo AA. Prevalence of bovine trypanosomosis in Taraba State, North-Eastern Nigeria. Tropical Vet. 2011;29(4):44–50.Google Scholar
  7. Majekodunmi AO, Fajinmi A, Dongkum C, Picozzi K, Thrusfield MV, Welburn SC. A longitudinal survey of African animal trypanosomiasis in domestic cattle on the Jos Plateau, Nigeria: prevalence, distribution and risk factors. Parasites and Vectors. 2013;6:239.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Fasanmi OG, Okoroafor UP, Nwufoh OC, Bukola-Oladele OM, Ajibola ES. Survey for Trypanosoma species in cattle from three farms in Iddo Local Government Area, Oyo State. Sokoto J Vet Sci. 2014;12(1):57–61.View ArticleGoogle Scholar
  9. Samdi S, Abenga JN, Fajinmi A, Kalgo A, Idowu T, Lawani F. Seasonal variation in trypanosomosis rates in small ruminants at the Kaduna abattoir, Nigeria. Afr J Biomed Res. 2008;11:229–32.Google Scholar
  10. Samdi SM, Fajinmi AO, Kalejaye JO, Wayo B, Haruna MK, Yarnap JE, et al. Periodic variation in Trypanosoma infection rates in trade small ruminants at slaughter in Kaduna Central abattoir. Research J Vet Sci. 2010;3:189–93. doi:10.3923/rjvs.2010.189.193.View ArticleGoogle Scholar
  11. Ohaeri CC. Prevalence of trypanosomiasis in ruminants in parts of Abia State, Nigeria. J Animal Vet Adv. 2010;9(8):2422–6.Google Scholar
  12. Kamani J, Turaki AU, Egwu GO, Mani AU, Saidu MK, Abdullahi JG, et al. Haemoparasites of camels (Camelus dromedarius) in Maiduguri, Nigeria. Animal Res Int. 2008;5(2):838–9.Google Scholar
  13. Mbaya AW, Ibrahim UI, Apagu ST. Trypanosomosis of The dromedary camel (Camelus dromedarius) and its vectors in the tsetse-free arid zone of North Eastern, Nigeria. Nigerian Vet. 2010;31(3):195–200.Google Scholar
  14. Rae DO, Kunkle WE, Chenoweth PJ, Sand RS, Tran T. Relationship of parity and body condition score to pregnancy rates in Florida Beef Cattle. Theriogenol. 1993;39:1143.View ArticleGoogle Scholar
  15. Lewis SM, Stoddart CT. Effects of anticoagulants and containers (glass and plastic) on the blood count. Lab Protoc. 1971;10(10):787–92.Google Scholar
  16. Kennedy JB, Machara KT, Baker AM. Cell and platelet stability in disodium and tripotassium EDTA. Am J Med Technol. 1981;47:89.PubMedGoogle Scholar
  17. Lanham SM, Godfrey DG. Isolation of salivarian trypanosomes from man and other mammals using DEAE-cellulose. Exp Parasitol. 1970;28:521–34.View ArticlePubMedGoogle Scholar
  18. Challier A, Laveissiere C. A new trap for capturing Glossina (Diptera Muscidae): description and field trials. Entomol Med Parasitol. 1973;11:251–62.Google Scholar
  19. Leak SGA. Tsetse biology and ecology: Their role in the epidemiology and control of trypanosomosis. Oxford: CABI Publishing; 1999. 568 pp.Google Scholar
  20. Zubairu A, Midau A, Dazala IU, Yahaya MM, Buba ZM. The prevalence of bovine trypanosomiasis in Song Local Government Area of Adamawa State, Nigeria. Global Veterinaria. 2013;11(3):310–3. doi:10.5829/idosi.gv.2013.11.3.7547.Google Scholar
  21. Njiokou F, Nimpaye H, Simo G, Njitchouang GR, Asonganyi T, Cuny G, et al. Domestic animals as potential reservoir hosts of Trypanosoma brucei gambiense in sleeping sickness foci in Cameroon. Parasite. 2010;17(1):61–6.View ArticlePubMedGoogle Scholar
  22. Njitchouang GR, Njiokou F, Djeunga HCN, Fewou PM, Asonganyi T, Cuny G, et al. Analysis of the domestic animal reservoir at a microgeographical scale, the Fontem sleeping sickness focus (South-West Cameroon). J Cell Animal Biol. 2010;4(5):73–80.Google Scholar
  23. Karshima NS, Ajogi I, Lawal AI, Mohammed G, Okubanjo OO. Detection of Trypanosoma brucei gambiense specific LiTat 1.3 antibodies in humans and cattle in Taraba State, North-Eastern Nigeria. J Vet Adv. 2012;2(12):580–5.Google Scholar
  24. Simo G, Asonganyi T, Nkinin SW, Njiokou F, Herder S. High prevalence of Trypanosoma brucei gambiense group 1 in pigs from the Fontem sleeping sickness focus in Cameroon. Vet Parasitol. 2010;139:57–66.View ArticleGoogle Scholar
  25. Hamill LC, Kaare MT, Welburn SC, Picozzi K. Domestic pigs as potential reservoirs of human and animal trypanosomiasis in Northern Tanzania. Parasit Vectors. 2013;6:322. http://www.parasitesandvectors.com/content/6/1/322.View ArticlePubMedPubMed CentralGoogle Scholar
  26. Losos GJ. Infectious tropical diseases of domestic animals. Protozoal diseases. Avon, UK: The Bath Press; 1986.Google Scholar
  27. Stephen LE. Trypanosoma vivax. Trypanosomiasis: a veterinary perspective. 1st ed. Oxford: Pergamon Press; 1986. p. 480–7.Google Scholar
  28. Desquesnes M, Dávila AMR. Applications of PCR-based tools for detection and identification of animal trypanosomes: a review and perspectives. Vet Parasitol. 2002;109:213–31.View ArticlePubMedGoogle Scholar
  29. Karshima NS, Lawal AI, Bata SI, Barde IJ, Pam VA, Dross PN, et al. Animal reservoirs of Trypanosoma brucei gambiense around the old Gboko sleeping sickness focus in Nigeria. J Parasitol Vect Biol. 2016;8(5):47–54.Google Scholar
  30. Daniel AD, Joshua RA, Kalejaiye JO, Dada AJ. Prevalence of trypanosomiasis in sheep and goats in a region of northern Nigeria. Rev Elev Med Vet Pays Trop. 1994;47(3):295–7.PubMedGoogle Scholar
  31. Shamaki BU, Obaloto OB, Kalejaiye JO, Lawani FAG, Balak GG, Charles D. A wet season survey of animal trypanosomosis in Shongom local government area of Gombe state, Nigeria. J Protozool Res. 2009;19:1–6.Google Scholar
  32. Dede PM, Halid I, Omoogun GA, Uzoigwe NR, Njoku CI, Daniel AD, et al. Current tsetse and trypanosomosis situation on Jos Plateau, Nigeria. Epizootiological factors that may enhance disease transmission and spread. Revue Elev Med Vet Pays Trop. 2005;58(1&2):31–5.Google Scholar
  33. Anosike JC, Opara MN, Okoli CG, Kyakya A, Okoli IC. Bovine trypanosomosis in sedentary cattle at previously assumed Trypanosoma-free Jos Plateau, Nigeria. Nigerian Vet J. 2003;24(1):33–6.Google Scholar
  34. Onah DN, Ebenebe OO. Isolation of human serum resistant Trypanosoma brucei from naturally infected pigs in Nsuka area of Enugu. Nigerian Vet J. 2003;24(1):37–43.Google Scholar
  35. Brun R, Schumacher R, Schmid C, Kunz C, Burri C. The phenomenon of treatment failures in human African typanosomiasis. Trop Med Intern Hlth. 2001;6:906–14.View ArticleGoogle Scholar
  36. Karshima NS, Ajogi I, Mohammed G, Lawal AI. A Survey for biting flies in three Local Government Areas of Taraba State, Nigeria. Sokoto J Vet Sci. 2011;9(1):36–8.Google Scholar
  37. Ahmed AB. A peridomestic population of the tsetse fly Glossina palpalis palpalis Robineau-desvoidy, 1830 (Diptera:Glossinidae) at Kontagora town, Niger State, Nigeria. Entomol Vect. 2004;11(4):599–610.View ArticleGoogle Scholar
  38. Ohaeri CC, Eluwa MC. The population structure and physiological status of tsetse flies in Abia State, Nigeria. J Animal Vet Adv. 2007;6(4):513–6.Google Scholar
  39. Baldry DAT. Species list of the tsetse flies, genus Glossina (Diptera: Muscidae) in Nigeria. Nigerian Entomol Mag. 1967;1:44.Google Scholar
  40. Oluwafemi R. Prevalence and distribution of tsetse fly (mainly Glossina palpalis palpalis and Glossina tachinoides) in BICOT Project area in Lafia Local Government of Nassarawa State, Nigeria - Implication for sustainable Agricultural development. Internet J Parasitic Dis. 2008;4(1):1–3.Google Scholar
  41. Alibu VP, Enyaru JKC, Matovu E, Malele II, Chisi JE, Mbongo N, et al. Molecular xenomonitoring of trypanosomes in tsetse flies. J Parasitol Vect Biol. 2015;7(6):108–14.Google Scholar
  42. Bekele JK, Asmare G, Abebe GA, Gelaye E. Evaluation of deltamethrin applications in the control of tsetse and trypanosomosis in the southern rift valley areas of Ethiopia. Vet Parasitol. 2010;168:177–84.View ArticlePubMedGoogle Scholar
  43. Desta M, Menkir S, Kebede A. The study on tsetse fly (Glossina species) and their role in the trypanosome infection rate in Birbir valley, Baro Akobo River system, Western Ethiopia. J Vet Med Animal Hlth. 2013;5(7):186–94. doi:10.5897/JVMAH2013.0223.Google Scholar
  44. Moser DR, Cook GA, Ochs DE, Bailey CP, McKane MR, Donelson JE. Detection of Trypanosoma congolense and Trypanosoma brucei subspecies by DNA amplification using the polymerase chain reaction. Parasitol. 1989;99:57–66.View ArticleGoogle Scholar
  45. Masiga DK, Smyth AJ, Hayes P, Bromidge TJ, Wendy CG. Sensitive detection of trypanosomes in tsetse flies by DNA amplification. Int J Parasitol. 1992;22:909–18.View ArticlePubMedGoogle Scholar
  46. Masake RA, Nantulya VM, Pelle R, Makau JM, Gathuo HOK. A species-specific antigen of Trypanosoma (Duttonella) vivax detectable in the course of infection is encoded by a differentially expressed tandemly reiterated gene. Mol Biochem Parasitol. 1994;64:207–18.View ArticlePubMedGoogle Scholar
  47. Konnai S, Mekata H, Mingala CN, Abes NS, Gutierrez CA, Herrera JR, et al. Development and application of a quantitative real-time PCR for the diagnosis of Surra in water buffaloes. Infect Genet Evol. 2009;9:449–52.View ArticlePubMedGoogle Scholar
  48. Radwanska M, Claes F, Magez S, Magnus E, Perez-morga D, Pays E, et al. Novel primer sequences for Polymerase Chain Reaction-based detection of Trypanosoma brucei gambiense. Am J Trop Med Hyg. 2002;67:289–95.PubMedGoogle Scholar
  49. Radwanska M, Chamekh M, Vanhamme L, Claes F, Magez S, Magnus E, et al. The serum resistance-associated gene as a diagnostic tool for the detection of Trypanosoma brucei rhodesiense. Am J Trop Med Hyg. 2002;67:684–90.PubMedGoogle Scholar

Copyright

© The Author(s). 2016

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Advertisement