Skip to content

Advertisement

Parasites & Vectors

Open Access

The presence of Giardia intestinalis in donkeys, Equus asinus, in China

  • Xiao-Xuan Zhang1, 2,
  • Fu-Kai Zhang1,
  • Fa-Cai Li1,
  • Jun-Ling Hou1,
  • Wen-Bin Zheng1,
  • Shuai-Zhi Du3,
  • Quan Zhao2 and
  • Xing-Quan Zhu1Email author
Parasites & Vectors201710:3

https://doi.org/10.1186/s13071-016-1936-0

Received: 26 August 2016

Accepted: 13 December 2016

Published: 3 January 2017

Abstract

Background

Giardia intestinalis is one of the most important zoonotic enteric parasites. As no information regarding prevalence and genotype of G. intestinalis in donkeys (Equus asinus) in China is available, 181 faecal samples from 48 donkeys from Jilin Province, from 104 from Shandong Province and from 29 from Liaoning Province were examined between May and December 2015.

Findings

Twenty-eight (15.47%) out of 181 donkey samples were tested G. intestinalis-positive by nested amplification of the triosephosphate isomerase (tpi) gene. The prevalence in different regional groups varied from 10.42 to 18.27%. The prevalence in adult and young donkeys was 14.29 and 22.92%, respectively. Otherwise, the prevalence was 11.69% in summer and 18.27% in winter. However, no statistically significant differences were found in relation to region or age group. Sequence analysis of the tpi, glutamate dehydrogenase (gdh) and beta giardin (bg) loci identified 4, 1 and 3 subtypes of assemblage B, respectively. Moreover, four novel multilocus genotypes (MLGs novel-1 to novel-4) were identified in assemblage B.

Conclusions

This first report of G. intestinalis in donkeys in China indicates that further studies of nation-wide molecular epidemiology and geographical distribution of Giardia in donkeys are warranted. Effective strategies should be implemented to control G. intestinalis infection in donkeys, other animals and humans.

Keywords

Giardia intestinalis PrevalenceGenotypingDonkeyChina

Background

Giardia intestinalis is the only species of Giardia which is found in human beings [14]. It is not only distributed worldwide, but also can infect many vertebrates [5, 6]. Eight assemblages (A-H) have been identified within G. intestinalis [68]. Of these, assemblages C-H seem to be animal-specific [9], but assemblages A and B can infect humans and a wide range of non-human hosts [6, 10]. Diarrhea is the main symptom of giardiasis [11] and transmission is mainly through ingestion of Giardia cysts in contaminated food or water [12]; approximately 2.8 × 108 cases of human giardiasis are reported world-wide per year, and the majority of them are reported in developing countries [6]. In view of such a serious situation, giardiasis has attracted considerable attention around the world. Although G. intestinalis infections have been reported in humans and a variety of animal species [1316], there is little information in donkeys (Equus asinus).

Giardia intestinalis infection in horses has been reported in many countries around the world including China [1721]. The donkey belongs to the genus Equus. It is an important edible animal species and used in Chinese traditional medicine, and is closely related to horses. Because they are maintained in a close association with their owners and veterinary personnel, donkeys are the important reservoirs for transmission of pathogens (such as Cryptosporidium hominis and Toxoplasma gondii) to humans and other animals [22, 23]. To determine whether donkeys are hosts of G. intestinalis, we conducted a study on the prevalence and genotypes of G. intestinalis in donkeys in Jilin, Liaoning and Shandong Provinces, China.

Methods

Collection and preparation of faecal samples

A total of 181 donkey faecal samples (48 from Jilin, 27 from Liaoning and 104 from Shandong) were collected from three provinces, in northeastern and eastern China, between March and December 2015. Each of the fresh faecal samples was collected into sterile gloves separately after its defecation onto the ground, placed into box with ice and transported to the laboratory immediately. Genomic DNA was extracted directly from each faecal sample using the Stool DNA kit (OMEGA, Norcross, Georgia, USA) according to the manufacturer’s instructions. Genomic DNA was stored at -20 °C until PCR amplification.

PCR amplification

The prevalence and genotypes of G. intestinalis were determined by the nested PCR amplification of the triosephosphate isomerase (tpi) gene, beta giardin (bg) gene and glutamate dehydrogenase (gdh) genes as described by Zhao et al. [24]. The primers and their annealing temperatures are listed in Table 1. Positive and negative controls were included in each amplification. Amplification products were observed under UV light after electrophoresis in 1.5% agarose gels containing GoldView™ (Solarbio, Beijing, China).
Table 1

Primers used in the study, annealing temperatures used in the PCRs and expected sizes of the PCR products

Gene

Primer

Sequence (5'-3')

Annealing temperature (°C)

Fragment length (bp)

Reference

tpi

F1

AAATIATGCCTGCTCGTCG

55

530

[24]

R1

CAAACCTTITCCGCAAACC

F2

CCCTTCATCGGIGGTAACTT

55

R2

GTGGCCACCACICCCGTGCC

gdh

F1

TTCCGTRTYCAGTACAACTC

50

530

[24]

R1

ACCTCGTTCTGRGTGGCGCA

F2

ATGACYGAGCTYCAGAGGCACGT

65

R2

GTGGCGCARGGCATGATGCA

bg

F1

AAGCCCGACGACCTCACCCGCAGTGC

50

511

[24]

R1

GAGGCCGCCCTGGATCTTCGAGACGAC

F2

GAACGAACGAGATCGAGGTCCG

60

R2

CTCGACGAGCTTCGTGTT

Sequence and phylogenetic analyses

Positive secondary PCR products were sequenced by Genscript Company (Nanjing, China). Bidirectional sequencing was used to confirm the accuracy of the sequences. Sequences with mutations were considered as novel genotypes when confirmed from independent two PCR reactions on the same sample. To identify the assemblages and subtypes, nucleotide sequences were aligned with known reference tpi, gdh and bg gene sequences of G. intestinalis available in GenBank using the BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) and computer program Clustal X 1.83.

Statistical analysis

The relationship between prevalence of G. intestinalis-infected donkeys and different variables including age, geographic origin and seasons were analyzed by Chi-square test using SPSS version 17.0 (SPSS Inc., Chicago, IL, USA) [25]. The results were considered significant statistically if P < 0.05. Odds ratios (ORs) and their 95% confidence intervals (CI) are also given.

Results and discussion

In this study, a total of 28 (15.47%, 95% CI: 10.20–20.74) out of 181 donkey samples were PCR-positive for G. intestinalis (Table 2). The prevalence was 22.92% (95% CI: 11.03–34.81) in young donkeys and 14.29% (95% CI: 8.34–20.23) in adults; no significant difference was observed (χ 2 = 1.90, df = 1, P = 0.17) (Table 2). The prevalence in summer and winter was 11.69% (95% CI: 4.51–18.87) and 18.27% (95% CI: 10.84–25.70), respectively (χ 2 = 1.47, df = 1, P = 0.23) (Table 2). Donkeys from Jilin Province (5/48, 10.42%, 95% CI: 1.78–19.06) had a lower prevalence than those from Shandong Province (19/104, 18.27%, 95% CI: 10.84–25.70) and Liaoning Province (4/29, 13.79%, 95% CI: 1.24–26.34); however, these differences were not significant (χ 2 = 1.62, df = 2, P = 0.44) (Table 2). Moreover, G. intestinalis prevalence in different farms ranged from 6.12 to 29.09% (Table 3). Sequences analysis of the tpi, gdh and bg loci indicated only assemblage B was found in the present study (Additional file 1: Figure S1).
Table 2

Factors associated with prevalence of Giardia intestinalis in donkeys in northern China

Factor

Category

No. tested

No. positive

% (95% CI)

P-value

OR (95% CI)

Region

Jilin Province

48

5

10.42 (1.78–19.06)

0.44

Reference

Liaoning Province

29

4

13.79 (1.24–26.34)

 

1.38 (0.34–5.60)

Shandong Province

104

19

18.27 (10.84–25.70)

 

1.92 (0.67–5.50)

Age

Adult

133

19

14.29 (8.34–20.23)

0.17

Reference

Young

48

11

22.92 (11.03–34.81)

 

1.33 (0.58–3.07)

Season

Summer

77

9

11.69 (4.51–18.87)

0.23

Reference

Winter

104

19

18.27 (10.84–25.70)

 

1.69 (0.72–3.97)

Total

 

181

28

15.47 (10.20–20.74)

  
Table 3

Giardia intestinalis genotypes identified in donkeys in different farms

Region

Farm ID

Age category (n)

No. positive/No. tested (%)

Genotype (n)

Jilin Province

Farm 1

Young (10); Adult (38)

5/48 (10.42)

BIV-1 (n = 2); BIV-novel-2 (n = 2); BIV-novel-3 (n = 1)

Liaoning Province

Farm 2

Young (6); Adult (23)

4/29 (13.79)

BIV-1 (n = 2); BIV-novel-3 (n = 1); BIV-novel-4 (n = 1)

Shandong Province

Farm 3

Young (14); Adult (35)

3/49 (6.12)

BIV-1 (n = 1); BIV-novel-4 (n = 2)

Farm 4

Young (18); Adult (37)

16/55 (29.09)

BIV-1 (n = 12); BIV-novel-3 (n = 4)

Total

 

Young (48); Adult (133)

28/181 (15.47)

BIV-1 (n = 17); BIV-novel-2 (n = 2); BIV-novel-3 (n = 6); BIV-novel-4 (n = 3)

The overall prevalence of G. intestinalis infection in donkeys was 15.47% (28/181, 95% CI: 10.20–20.74), which was higher than that in horses in Xinjiang (1.5%) [17], Brazil (0.5%) [26], foals in Belgium (14.2%) [20], Germany (10%) [20], Greece (11.6%) [20], the Netherlands (11.4%) [20] and Italy (8.6%) [18], but lower than that in horses in Colombia (17.4%) [19]. Previous studies demonstrated that survival of G. intestinalis is more likely to be affected by climate (temperature and relative humidity) [6, 27], so the difference in G. intestinalis prevalence in different regions may be due to different local climatic conditions, as well as the detection methods, sampling time and sample sizes. Moreover, probably because of the smaller sample sizes, seasonal and age-related correlates previously found in cattle [6] and horses [20] were not found in this study.

Assemblages A and B, responsible for the vast majority of human giardiasis [6, 28], and assemblage E, a common assemblage of G. intestinalis in cattle [9], have also been reported in horses [20]. However, perhaps due to the smaller sample sizes, only assemblage B was identified in donkeys in the present study. Assemblage B has a broad host range worldwide [20, 28]. In China, isolates of assemblage B have also been found in non-human primates [2], rabbits [3], horses [17], cattle [29], golden takins (Budorcas taxicolor bedfordi) [24], pet chinchillas (Chinchilla lanigera) [30], captive wildlife [13], sheep [31] and goats [31], suggesting interspecies transmission of G. intestinalis may be commonly occurring in China, and we should pay enough attention to. More importantly, assemblage B was also identified in raw urban wastewater in northern China [32]. Therefore, our results also suggest that donkeys could be a source of giardiasis outbreaks.

Mixed infections of G. intestinalis genotypes have been recorded from a wide range of hosts worldwide [29, 33]. In cases of co-infections, some assemblages may be detected preferentially using a single locus primers [34]; thus PCR amplification of a single locus may not reflect the accurate information to G. intestinalis infection [34, 35]. A multilocus genotype (MLG) method (tpi, gdh and bg loci) has been developed and widely used for detection of G. intestinalis infection [6, 33, 34]. In the present study, 28 G. intestinalis-positive samples were also genotyped based on bg and gdh loci. A total of 28 tpi, 22 bg and 16 gdh gene sequences were obtained, and analysis of these genes revealed only one assemblage (B); however, high genetic polymorphism was observed at these loci within this assemblage (Table 4), implying high genetic diversity of G. intestinalis in donkeys in the investigation regions. At the tpi locus, seven polymorphic sites were found compared with the GenBank reference sequence AY368169 (Table 4), and four different assemblage B subtypes were identified (Table 4, Additional file 1: Figure S1c). These sequences all represented new subtypes (KU892519–KU892522), and showed a 99% similarity with the reference sequence (accession no. AY368169, from wastewater in USA [36]). Only one subtype was found at the gdh locus (Additional file 1: Figure S1b), and the sequence (KU892523) had 99% similarity with the reference sequence available in GenBank with accession number of KR048463 (from a takin in China [24]). Moreover, a total of five SNPs were observed at the bg locus (Table 4), and these sequences (KU892516–KU892518) represented three subtypes (Additional file 1: Figure S1a). Moreover, these subtypes were closely clustered with sub-assemblage BIV (Additional file 1: Figure S1), suggesting that sub-assemblage BIV was the most common subtype in donkeys in the investigated regions. Furthermore, phylogenetic analysis of these isolates showed that these isolates exhibit close relationship with isolates from horses, humans and chinchillas, suggesting that transmission of G. intestinalis may be occurring among these hosts.
Table 4

Variations in tpi, gdh and bg nucleotide sequences among the subtypes of Giardia intestinalis assemblage B

Locus

Subtype (n)

Nucleotide at position

GenBank ID

tpi

 

10

11

16

182

197

384

525

 
 

Ref. sequence

C

G

G

A

G

G

AY368169

BIV-1a (n = 17)

C

G

A

G

A

G

KU892520

BIV-novel-2 (n = 2)

T

C

G

A

G

A

G

KU892519

BIV-novel-3 (n = 6)

T

C

A

G

A

G

KU892521

BIV-novel-4 (n = 3)

T

G

A

G

A

T

KU892522

gdh

 

219

       
 

Reference sequence

G

      

KR048463

BIV-novel-1 (n = 16)

C

      

KU892523

bg

 

14

179

248

446

447

   
 

Reference sequence

G

C

C

A

G

  

KM926514

BIV-1b (n = 12)

G

C

C

G

A

  

KU892517

BIV-2b (n = 4)

G

T

C

G

A

  

KU892518

Bb-7c (n = 6)

A

C

T

G

A

  

KU892516

aIdentified by Qi et al. [17]

bIdentified by Coronato Nunes et al. [37]

cIdentified by Karim et al. [2]

Furthermore, 10 out of 28 positive isolates were successfully amplified at all three loci. These samples provided four novel MLGs in the assemblage B, namely MLGs novel-1 to novel-4 (Table 5, Fig. 1). Of these, MLG novel-1 (n = 5) was the most prevalent MLG, and responsible for 50% of all MLGs in the present study. These findings suggest a high genetic diversity of this prevalent genotype in donkeys in China, in agreement with previous conclusions that G. intestinalis isolates of the same assemblage may be grouped into distinct MLGs [6, 24].
Table 5

Multilocus characterization of Giardia intestinalis assemblage B isolates from donkeys at tpi, gdh and bg loci

Isolate (n)

Genotype

GenBank ID

MLGs

L7 (5)

BIV-1, BIV-novel-1, BIV-1

KU892520, KU892523, KU892516

novel-1

L13 (1)

BIV-novel-2, BIV-novel-1, BIV-2

KU892519, KU892523, KU892517

novel-2

L64 (2)

BIV-novel-3, BIV-novel-1, Bb-7

KU892521, KU892523, KU892518

novel-3

L93 (2)

BIV-1, BIV-novel-1, Bb-7

KU892520, KU892523, KU892518

novel-4

Fig. 1

Phylogenetic relationships of Giardia intestinalis inferred by the neighbour-joining analysis of concatenated β-giardin, gdh and tpi gene sequences. Multi-locus genotypes from a previous study (Lebbad et al. [38]) are indicated. The bootstrapping was performed using 1000 replicates. Isolates identified in this study are indicated by solid circles

Conclusions

The present study demonstrated the occurrence of G. intestinalis infection in donkeys in China. Sequences analysis suggested that all the G. intestinalis isolates represented assemblage B, with four, one and three subtypes of assemblage B at the tpi gdh and bg loci, respectively. Moreover, four novel MLGs (MLGs novel-1 to novel-4) were identified within assemblage B. The results of the present study not only improve the information of the distribution of G. intestinalis genotypes in China, but also provide the foundation data for preventing and controlling G. intestinalis infection in donkeys, other animals and humans.

Abbreviations

bg

Beta giardin gene

CI: 

Confidence interval

gdh

Glutamate dehydrogenase gene

MLG: 

Multilocus genotype

OR: 

Odds ratio

tpi

Triosephosphate isomerase (tpi) gene

Declarations

Acknowledgements

The authors thank the staff and workers in the donkey farms who helped in the collection of faecal samples.

Funding

This work was supported by the Agricultural Science and Technology Innovation Program (ASTIP) (Grant No. CAAS-ASTIP-2014-LVRI-03).

Availability of data and material

Representative nucleotide sequences were deposited in GenBank with the following accession numbers: KU892516–KU892518 for the bg gene, and KU892519–KU892522 for the tpi gene, and KU892523 for the gdh gene.

Authors’ contributions

XQZ and QZ conceived and designed the study, and critically revised the manuscript. XXZ, FKZ and WBZ performed the experiments. XXZ and FKZ analyzed the data. XXZ drafted the manuscript. FCL, JLH and SZD helped in study design, study implementation and manuscript preparation. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval

This study was approved by the Animal Ethics Committee of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (Approval No. LVRIAEC2014-011). Donkeys used for the study were handled in accordance with good animal practices required by the Animal Ethics Procedures and Guidelines of the People's Republic of China.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, People’s Republic of China
(2)
College of Animal Science and Technology, Jilin Agricultural University, Changchun, People’s Republic of China
(3)
Qilu Animal Health Products Co., Ltd., Jinan, People’s Republic of China

References

  1. Minetti C, Lamden K, Durband C, Cheesbrough J, Fox A, Wastling JM. Determination of Giardia duodenalis assemblages and multi-locus genotypes in patients with sporadic giardiasis from England. Parasit Vectors. 2015;8:444.View ArticlePubMedPubMed CentralGoogle Scholar
  2. Karim MR, Wang R, Yu F, Li T, Dong H, Li D, et al. Multi-locus analysis of Giardia duodenalis from nonhuman primates kept in zoos in China: geographical segregation and host-adaptation of assemblage B isolates. Infect Genet Evol. 2015;30:82–8.View ArticlePubMedGoogle Scholar
  3. Qi M, Xi J, Li J, Wang H, Ning C, Zhang L. Prevalence of zoonotic Giardia duodenalis assemblage B and first identification of assemblage E in rabbit fecal samples isolates from Central China. J Eukaryot Microbiol. 2015;62:810–4.View ArticlePubMedGoogle Scholar
  4. De Liberato C, Berrilli F, Marangi M, Santoro M, Trogu T, Putignani L, et al. Giardia duodenalis in Alpine (Rupicapra rupicapra rupicapra) and Apennine (Rupicapra pyrenaica ornata) chamois. Parasit Vectors. 2015;8:650.View ArticlePubMedPubMed CentralGoogle Scholar
  5. Feng Y, Xiao L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin Microbiol Rev. 2011;24:110–40.View ArticlePubMedPubMed CentralGoogle Scholar
  6. Zhang XX, Tan QD, Zhao GH, Ma JG, Zheng WB, Ni XT, et al. Prevalence, risk factors and multilocus genotyping of Giardia intestinalis in dairy cattle, northwest China. J Eukaryot Microbiol. 2016;63:498–504.View ArticlePubMedGoogle Scholar
  7. Ramírez JD, Heredia RD, Hernández C, León CM, Moncada LI, Reyes P, et al. Molecular diagnosis and genotype analysis of Giardia duodenalis in asymptomatic children from a rural area in central Colombia. Infect Genet Evol. 2015;32:208–13.View ArticlePubMedGoogle Scholar
  8. Santin M, Fayer R. Enterocytozoon bieneusi, Giardia, and Cryptosporidium infecting white-tailed deer. J Eukaryot Microbiol. 2015;62:34–43.View ArticlePubMedGoogle Scholar
  9. Sprong H, Cacciò SM, van der Giessen JW, ZOOPNET network and partners. Identification of zoonotic genotypes of Giardia duodenalis. PLoS Negl Trop Dis. 2009;3, e558.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Mohamed AS, Levine M, Camp JW, Jr Lund E, Yoder JS, Glickman LT, et al. Temporal patterns of human and canine Giardia infection in the United States: 2003–2009. Prev Vet Med. 2014;113:249–56.View ArticlePubMedGoogle Scholar
  11. Shin JC, Reyes AW, Kim SH, Kim S, Park HJ, Seo KW, et al. Molecular detection of Giardia intestinalis from stray dogs in animal shelters of Gyeongsangbuk-do (Province) and Daejeon, Korea. Korean J Parasitol. 2015;53:477–81.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Karanis P, Kourenti C, Smith H. Waterborne transmission of protozoan parasites: a worldwide review of outbreaks and lessons learnt. J Water Health. 2007;5:1–38.View ArticlePubMedGoogle Scholar
  13. Li J, Qi M, Chang Y, Wang R, Li T, Dong H, et al. Molecular characterization of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in captive wildlife at Zhengzhou Zoo, China. J Eukaryot Microbiol. 2015;62:833–9.View ArticlePubMedGoogle Scholar
  14. Ehsan AM, Geurden T, Casaert S, Parvin SM, Islam TM, Ahmed UM, et al. Assessment of zoonotic transmission of Giardia and Cryptosporidium between cattle and humans in rural villages in Bangladesh. PLoS One. 2015;10, e0118239.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Cacciò SM, Ryan U. Molecular epidemiology of giardiasis. Mol Biochem Parasitol. 2008;160:75–80.View ArticlePubMedGoogle Scholar
  16. Bouzid M, Halai K, Jeffreys D, Hunter PR. The prevalence of Giardia infection in dogs and cats, a systematic review and meta-analysis of prevalence studies from stool samples. Vet Parasitol. 2015;207:181–202.View ArticlePubMedGoogle Scholar
  17. Qi M, Zhou H, Wang H, Wang R, Xiao L, Arrowood MJ, et al. Molecular identification of Cryptosporidium spp. and Giardia duodenalis in grazing horses from Xinjiang, China. Vet Parasitol. 2015;209:169–72.View ArticlePubMedGoogle Scholar
  18. Traversa D, Otranto D, Milillo P, Latrofa MS, Giangaspero A, Di Cesare A, et al. Giardia duodenalis sub-assemblage of animal and human origin in horses. Infect Genet Evol. 2012;12:1642–6.View ArticlePubMedGoogle Scholar
  19. Santín M, Cortés Vecino JA, Fayer R. A large scale molecular study of Giardia duodenalis in horses from Colombia. Vet Parasitol. 2013;196:31–6.View ArticlePubMedGoogle Scholar
  20. Kostopoulou D, Casaert S, Tzanidakis N, van Doorn D, Demeler J, von Samson-Himmelstjerna G, et al. The occurrence and genetic characterization of Cryptosporidium and Giardia species in foals in Belgium, the Netherlands, Germany and Greece. Vet Parasitol. 2015;211:170–4.View ArticlePubMedGoogle Scholar
  21. Veronesi F, Passamonti F, Cacciò S, Diaferia M, Piergili FD. Epidemiological survey on equine Cryptosporidium and Giardia infections in Italy and molecular characterization of isolates. Zoonoses Public Health. 2010;57:510–7.View ArticlePubMedGoogle Scholar
  22. Jian F, Liu A, Wang R, Zhang S, Qi M, Zhao W, et al. Common occurrence of Cryptosporidium hominis in horses and donkeys. Infect Genet Evol. 2016;43:261–6.View ArticlePubMedGoogle Scholar
  23. Alvarado-Esquivel C, Alvarado-Esquivel D, Dubey JP. Prevalence of Toxoplasma gondii antibodies in domestic donkeys (Equus asinus) in Durango, Mexico slaughtered for human consumption. BMC Vet Res. 2015;11:6.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Zhao GH, Du SZ, Wang HB, Hu XF, Deng MJ, Yu SK, et al. First report of zoonotic Cryptosporidium spp., Giardia intestinalis and Enterocytozoon bieneusi in golden takins (Budorcas taxicolor bedfordi). Infect Genet Evol. 2015;34:394–401.View ArticlePubMedGoogle Scholar
  25. Xu H, Jin Y, Wu W, Li P, Wang L, Li N, et al. Genotypes of Cryptosporidium spp., Enterocytozoon bieneusi and Giardia duodenalis in dogs and cats in Shanghai, China. Parasit Vectors. 2016;9:121.View ArticlePubMedPubMed CentralGoogle Scholar
  26. De Souza PN, Bomfim TC, Huber F, Abboud LC, Gomes RS. Natural infection by Cryptosporidium sp., Giardia sp. and Eimeria leuckarti in three groups of equines with different handlings in Rio de Janeiro, Brazil. Vet Parasitol. 2009;160:327–33.View ArticlePubMedGoogle Scholar
  27. Alum A, Absar IM, Asaad H, Rubino JR, Ijaz MK. Impact of environmental conditions on the survival of Cryptosporidium and Giardia on environmental surfaces. Interdiscip Perspect Infect Dis. 2014;2014:210385.PubMedPubMed CentralGoogle Scholar
  28. Ballweber LR, Xiao L, Bowman DD, Kahn G, Cama VA. Giardiasis in dogs and cats: update on epidemiology and public health significance. Trends Parasitol. 2010;26:180–9.View ArticlePubMedGoogle Scholar
  29. Huang J, Yue D, Qi M, Wang R, Zhao J, Li J, et al. Prevalence and molecular characterization of Cryptosporidium spp. and Giardia duodenalis in dairy cattle in Ningxia, northwestern China. BMC Vet Res. 2014;10:292.View ArticlePubMedPubMed CentralGoogle Scholar
  30. Qi M, Yu F, Li S, Wang H, Luo N, Huang J, et al. Multilocus genotyping of potentially zoonotic Giardia duodenalis in pet chinchillas (Chinchilla lanigera) in China. Vet Parasitol. 2015;208:113–7.View ArticlePubMedGoogle Scholar
  31. Zhang W, Zhang X, Wang R, Liu A, Shen Y, Ling H, et al. Genetic characterizations of Giardia duodenalis in sheep and goats in Heilongjiang Province, China and possibility of zoonotic transmission. PLoS Negl Trop Dis. 2012;6, e1826.View ArticlePubMedPubMed CentralGoogle Scholar
  32. Liu A, Ji H, Wang E, Liu J, Xiao L, Shen Y, et al. Molecular identification and distribution of Cryptosporidium and Giardia duodenalis in raw urban wastewater in Harbin. China Parasitol Res. 2011;109:913–8.View ArticlePubMedGoogle Scholar
  33. Ankarklev J, Hestvik E, Lebbad M, Lindh J, Kaddu-Mulindwa DH, Andersson JO, et al. Common coinfections of Giardia intestinalis and Helicobacter pylori in non-symptomatic Ugandan children. PLoS Negl Trop Dis. 2012;6, e1780.View ArticlePubMedPubMed CentralGoogle Scholar
  34. Cacciò SM, Beck R, Lalle M, Marinculic A, Pozio E. Multilocus genotyping of Giardia duodenalis reveals striking differences between assemblages A and B. Int J Parasitol. 2008;38:1523–31.View ArticlePubMedGoogle Scholar
  35. Wielinga CM, Thompson RC. Comparative evaluation of Giardia duodenalis sequence data. Parasitology. 2007;134:1795–821.View ArticlePubMedGoogle Scholar
  36. Sulaiman IM, Jiang J, Singh A, Xiao L. Distribution of Giardia duodenalis genotypes and subgenotypes in raw urban wastewater in Milwaukee, Wisconsin. Appl Environ Microbiol. 2004;70:3776–80.View ArticlePubMedPubMed CentralGoogle Scholar
  37. Coronato Nunes B, Pavan MG, Jaeger LH, Monteiro KJ, Xavier SC, Monteiro FA, et al. Spatial and molecular epidemiology of Giardia intestinalis deep in the Amazon, Brazil. PLoS One. 2016;11, e0158805.View ArticlePubMedPubMed CentralGoogle Scholar
  38. Lebbad M, Mattsson JG, Christensson B, Ljungström B, Backhans A, Andersson JO, et al. From mouse to moose: multilocus genotyping of Giardia isolates from various animal species. Vet Parasitol. 2010;168:231–9.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s). 2017

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Advertisement