Skip to content

Advertisement

  • Short report
  • Open Access

First identification and multilocus genotyping of Giardia duodenalis in pet chipmunks (Eutamias asiaticus) in Sichuan Province, southwestern China

  • 1,
  • 1,
  • 1,
  • 1,
  • 1,
  • 1,
  • 1,
  • 1,
  • 1,
  • 1,
  • 1 and
  • 1Email author
Contributed equally
Parasites & Vectors201811:199

https://doi.org/10.1186/s13071-018-2790-z

  • Received: 27 November 2017
  • Accepted: 8 March 2018
  • Published:

Abstract

Background

Giardia duodenalis is a flagellated parasite that causes diarrhea in humans and other animals. Although G. duodenalis is found in companion animals worldwide, information regarding the prevalence and genetic characteristics of G. duodenalis in pet chipmunks in China is limited. The present study therefore aimed to investigate the prevalence and genotypes of G. duodenalis in pet chipmunks in Sichuan province, southwestern China, as well as to assess zoonotic potential of revealed assemblages.

Results

A total of 279 fecal samples were collected from pet chipmunks in seven pet shops and one breeding facility in Sichuan province, southwestern China. The prevalence of G. duodenalis was 8.6% (24/279), as determined by nested PCR detection of the beta giardin (bg) gene. Giardia duodenalis assemblages and subtypes were determined using multilocus genotyping of the bg, triosephosphate isomerase (tpi), and glutamate dehydrogenase (gdh) loci. Two assemblages were identified: potentially zoonotic assemblage A (54.2%, 13/24) and rodent-specific assemblage G (45.8%, 11/24). A total of 24, 17 and 17 sequences of the bg, gdh and tpi loci, respectively, were successfully obtained, which formed four, four and three subtypes, respectively. Moreover, four assemblage A (MLGs A1-A4) and three assemblage G (MLGs G1-G3) multilocus genotypes were identified.

Conclusions

To our knowledge, this is the first study that investigated G. duodenalis in pet chipmunks in China. Detection of assemblage A in pet chipmunks and in previous studies in humans suggests a possible role of chipmunks as a reservoir for human giardiasis in Sichuan Province, China.

Keywords

  • Giardia duodenalis
  • Chipmunk
  • Assemblage
  • Multilocus genotype

Background

Giardia duodenalis is a common enteric parasite that infects a broad spectrum of vertebrate hosts, including humans, livestock, companion animals and wildlife worldwide [1]. Usually, humans and animals become infected with G. duodenalis via fecal-oral route by ingesting infective stage cysts in contaminated food or water [2]. Clinical manifestations vary depending upon the immunological status of the host [3]. In immunocompetent individuals, G. duodenalis causes self-limiting diarrhea and malabsorption, whereas in infants, elderly persons, and individuals with deficient immune system, it also can cause chronic or life-threatening diarrhea and weight loss [4, 5].

Molecular studies have demonstrated that G. duodenalis comprises at least eight genetically distinct assemblages (A-H) [6]. Assemblages A and B, considered zoonotic genotypes, can infect humans and a wide range of mammalian hosts, whereas the remaining assemblages (C-H) seem to be host-specific [7]. Assemblages C and D mainly infect dogs, assemblage E livestock, assemblage F cats, assemblage G rodents, and assemblage H marine mammals [8, 9]. So far, assemblages A and B have been determined as predominant genetic sub-populations of Giardia in pet rodents in countries such as Spain, Italy, Australia, Belgium and China [1012]. In addition, assemblages C, G, and E have been also occasionally identified in pet rodents [12, 13].

In China, epidemiological data about Giardia prevalence have been reported in domestic dogs and cats (assemblages C and D) [14], raccoon dogs (assemblages C and D) [15], cattle (A, B, and E) [16], horses (assemblages A and B) [17], sheep, goats (assemblages A, B and E) [18, 19], pet chinchillas (assemblages A and B) [11], as well as in humans (assemblages A and B) [20]. Recently, chipmunks (Eutamias asiaticus) have become popular in China as companion animals. As such, they have been commercially bred in significant numbers in many breeding facilities. However, information regarding G. duodenalis infection in pet chipmunks in China is rare, and the zoonotic potential of this parasite in chipmunks remains unknown. Therefore, the purpose of this study was to identify the prevalence and assemblages of G. duodenalis in pet chipmunks and to determine the genetic characteristics of G. duodenalis-positive samples.

Methods

Specimen collection

From March 2016 to April 2017, 279 fecal specimens were collected from chipmunks in seven pet shops and one breeding facility located in Sichuan province, southwestern China (Additional file 1: Table S1). Chipmunks were bred in individual cages. Fecal samples were collected from the bottom of the each cage, immediately placed into individual 30 ml sterile containers, and taken to the laboratory in a cooler with ice packs within 24 h. At sampling time, the age, sex, and health condition were recorded. All chipmunks whose fecal samples were examined were in apparently good health at the time of sampling.

DNA extraction and PCR amplification

All fecal specimens were washed three times by centrifugation at 1500× g for 10 min with distilled water. Genomic DNA was extracted from approximately 200 mg of each processed fecal specimen using an E.Z.N.A.R® Stool DNA kit (Omega Biotek Inc., Norcross, GA, USA) according to the manufacturer’s instructions. Extracted DNA was stored at -20 °C until molecular analysis.

Giardia duodenalis prevalence and assemblages were first determined by nested PCR amplification of approximately 550 bp fragment of the beta giardin (bg) gene. Furthermore, bg-positive specimens were also analyzed by PCR amplification of the glutamate dehydrogenase (gdh) and triosephosphate isomerase (tpi) genes. PCR amplification primers and annealing temperatures in this study (Table 1) were as previously reported [21]. PCR products were visualized by electrophoresis in 1.5% agarose containing ethidium bromide.
Table 1

Primer sequences, annealing temperatures and the fragment lengths of the genes used in this study

Gene

Primer

Sequence (5'-3')

Annealing temperature (°C)

Fragment length (bp)

Reference

bg

F1

AAGCCCGACGACCTCACCCGCAGTGC

65

530

[21]

R1

GAGGCCGCCCTGGATCTTCGAGACGAC

F2

GAGGCCGCCCTGGATCTTCGAGACGAC

65

R2

CATAACGACGCCATCGCGGCTCTCAGGAA

tpi

F1

AAATIATGCCTGCTCGTCG

50

530

[21]

R1

CAAACCTTITCCGCAAACC

F2

CCCTTCATCGGIGGTAACTT

50

R2

GTGGCCACCACICCCGTGCC

gdh

F1

TTCCGTRTYCAGTACAACTC

50

511

[21]

R1

ACCTCGTTCTGRGTGGCGCA

F2

ATGACYGAGCTYCAGAGGCACGT

50

R2

GTGGCGCARGGCATGATGCA

Sequence and phylogenetic analyses

All amplified products were sent to Life Technologies (Guangzhou, China) for sequencing on an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, CA, USA) using the BigDye® Terminator v3.1 cycle sequencing kit. Nucleotide sequence accuracy was confirmed by sequencing two separate PCR products. Assemblages and subtypes were identified by aligning nucleotide sequences with known reference tpi, gdh and bg gene sequences of G. duodenalis available in GenBank using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/).

A phylogenetic analysis was performed by constructing a neighbor-joining tree using Mega 6 software [12], based on the evolutionary distances calculated by a Kimura 2-parameter model. The reliability of these trees was assessed using bootstrap analysis with 1000 replicates.

Results and discussion

The present study identified 24 (8.6%, 95% CI: 0.053–0.119%) fecal samples that were G. duodenalis-positive by PCR analysis of the bg gene. In China, the prevalence of giardiasis varies from 1.9% [22] to 27.1% [11] in pets by PCRs. In Heilongjiang Province, the rates of infection with G. duodenalis in pet cats and dogs were 1.9 and 4.5%, respectively [22]. In Guangzhou, 11% of fecal samples form pet dogs were positive for G. duodenalis [23]. The prevalence of G. duodenalis in pet dogs in Henan Province was 12.4% [14]. In Niaoning Province, the infection rate of G. duodenalis in farm dogs was 13.2% [24]. In Shanghai, Hualiu et al. [25] reported that G. duodenalis was found in 26.67 and 9.26% of samples from pets and zoo animals, respectively. The infection rate of G. duodenalis in pet chinchillas was 27.1% in four different cities in China [11]. The variability of G. duodenalis prevalence in China may be explained by the differences in geographical location, climate, age and gender of the animals, management system, and the diagnostic method.

The genetic diversity of G. duodenalis-positive samples was observed by sequencing the bg, tpi and gdh genes. A total of 24, 17 and 17 sequences were obtained for the three gene loci, respectively (Table 2). Analysis of the bg gene identified 13 sequences as belonging to assemblage A (9 subtype AI and 4 subtype AI-1) and 11 to assemblage G (7 subtype GI and 4 subtype GII). The subtype AI sequence (MF671918) was identical to the known assemblage AI sequences: accession no. KR051224 (from tortoise in China) and accession no. GQ329671 (from human in Sweden [26]). The subtype AI-1 sequence (MF671917) had one single nucleotide polymorphism (SNP) when compared to sequence KR051224 (Table 3). The subtype GI sequence (MF671919) was identical to sequence EU769221 (from Rattus norvegicus in Sweden), whereas the subtype GII sequence had two SNPs (at position 97 G/A, and at position 325 A/C) in comparison with sequence EU769221. Among 17 samples positive for the tpi gene, 13 sequences were identified as assemblage A (5 subtype AI and 8 subtype AV) and 4 were identified as assemblage G (2 subtype GI and 2 subtype GII). The genetic characterization is presented in Table 3. Subtype GII sequence (MF671913) was identical to sequence EU781013 (from Rattus norvegicus in Sweden), whereas subtype GI sequence had one SNP (at position 184 C/T) in comparison with sequence EU781013. Out of 17 samples positive for the gdh gene, 10 sequences were identified as belonging to assemblage A (7 subtype AI and 3 novel subtypes AI-1) and 7 were identified as belonging to assemblage G. The novel subtype AI-1 sequence had not been reported previously; it had 5 SNPs when compared with sequence KR075940 (from sheep in China [27]) (Table 3). Assemblage G sequence was identical to sequence AY178748 (from mouse in Australia). The phylogenetic trees based on bg, gdh and tpi are presented in Additional file 2: Figure S1.
Table 2

Assemblages of Giardia duodenalis and the distribution of bg, tpi and gdh sequences for each positive samples and multilocus characterization

Chipmunk ID

Assemblage

GenBank ID

MLG type (n)

bg

tpi

gdh

CD26, CD27

GI

GI

G

MF671919, MF671914, MF671912

MLG G1 (2)

CD28

GI

GII

G

MF671919, MF671913, MF671912

MLG G2 (1)

CD79

GII

GII

G

MF671920, MF671913, MF671912

MLG G3 (1)

CD29, CD34, CD69

AI

AV

AI-1

MF671918, MF671915, MF671910

MLG A1 (3)

CD60, CD119

AI

AI

AI

MF671918, MF671916, MF671911

MLG A2 (2)

CD61, CD96, CD124, CD144

AI-1

AV

AI

MF671917, MF671915, MF671911

MLG A3 (4)

CD64

AI

AV

AI

MF671918, MF671915, MF671911

MLG A4 (1)

CD74, CD92, CD186

AI

AI

Neg

MF671918, MF671916, –

CD81, CD203, CD211

GII

Neg

Neg

MF671920, –, –

CD22, CD44, CD102

GI

Neg

G

MF671919, –, MF671912

CD23

GI

Neg

Neg

MF671919, –, –

Abbreviations: Neg no genotype determined; – GenBank accession numbers not available

Table 3

Variations in the bg, tpi and gdh genes among Giardia duodenalis assemblage A isolates from chipmunks in Sichuan Province, southwestern China

Subtype

GenBank ID

Gene

Nucleotide at position

74

248

275

287

443

469

AI (Ref.)

KR051224

bg

A

A

C

A

A

T

AI

MF671918

bg

A

A

C

A

A

T

AI-1

MF671917

bg

A

A

C

C

A

T

AI (Ref.)

EU014517

tpi

C

A

A

A

C

G

AI

MF671916

tpi

C

A

A

A

C

G

AV (Ref.)

KP780973

tpi

C

T

C

G

A

T

AV

MF671915

tpi

C

T

C

G

A

T

AI (Ref.)

KR075940

gdh

C

T

G

G

C

A

AI

MF671911

gdh

C

T

G

G

C

A

AI-1

MF671910

gdh

T

C

A

G

T

C

In the present study, assemblage A sequences were more prevalent than assemblage G sequences, and no mixed assemblage A and G infections were detected. This result is consistent with data from previous studies in pets in China and Mexico [24, 28]. Thus far, assemblages A-C, E and G have been identified in rodents worldwide, and nearly all tested samples contained at least either assemblage A or B [12, 13]. Subtyping assemblage A sequences at different loci has revealed three sub-assemblages: AI, AII, and AIII. In China, sub-assemblage AI has been detected in a variety of hosts, including humans, cattle, goat, sheep, dogs, cats and pigs [7]. Sub-assemblage AII has also been identified in humans in China. Cross-species transmission of G. duodenalis assemblage AI in Mexico and in Brazil has been recently reported [28, 29]. This finding suggests that chipmunks infected with assemblage AI were probably the source of human giardiasis due to frequent contact of the two species in that specific area. However, the generalization of this proposal requires systematic, molecular epidemiological investigations in humans and animals in other geographical areas. Recently, the multilocus genotype (MLG) model has been widely used to better understand the characteristics of G. duodenalis in different hosts and to assess its zoonotic potential [30, 31]. In this study, 14 samples were successfully sequenced at all three gene loci, and were characterized as four assemblage A MLGs and three different assemblage G MLGs (Table 2).

Conclusions

In the present study, for the first time, we described the rates of infection with G. duodenalis of pet chipmunks in Sichuan province of southwestern China and demonstrated the prevalence of assemblages A and G. On the basis of the multilocus sequence analysis, four assemblage A MLGs and three assemblage G MLGs were identified. Because assemblage A G. duodenalis is known to be zoonotic and has been identified in humans in China, pet chipmunks infected with assemblage A constitute a potential zoonotic risk to humans.

Abbreviations

bg

β-giardin

tpi

Triosephosphate isomerase

gdh

Glutamate dehydrogenase

MLGs: 

Multilocus genotype

SNP: 

Single nucleotide polymorphism

Declarations

Acknowledgements

We would like to thank Qicheng Xiao and Rui Tu for collecting samples.

Funding

The study was supported financially by the National Science and Technology Department “13th five-year” Special Subproject of China (No. 2016YFD0501009) and the Chengdu Giant Panda Breeding Research Foundation (CPF2015-09; CPF2015-07).

Availability of data and materials

Representatives of all the nucleotide sequences generated in this study have been deposited in GenBank under the accession numbers MF671910-MF671920.

Authors’ contributions

GP and LD conceived and designed the experiments. RL, HL, YC, ZZ1 (Ziyao Zhou) and LY collected samples. Experiments were performed by LD, WW, HF, LL and ZZ2 (Zhijun Zhong), and the data were analyzed by LD, HF and SC. The manuscript was written by LD. All authors read and approved the final manuscript.

Ethics approval

The present study protocol was reviewed and approved by the Research Ethics Committee and the Animal Ethical Committee of Sichuan Agricultural University. Permission was obtained from the shop owners before the fecal specimens were collected.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
The Key Laboratory of Animal Disease and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan Province, 611130, China

References

  1. Xiao L, Fayer R. Molecular characterisation of species and genotypes of Cryptosporidium and Giardia and assessment of zoonotic transmission. Int J Parasitol. 2008;38:1239–55.View ArticlePubMedGoogle Scholar
  2. Umapathy G, Mynářová A, Foitová I, Kváč M, Květoňová D, Rost M, et al. Prevalence of Cryptosporidium spp., Enterocytozoon bieneusi, Encephalitozoon spp. and Giardia duodenalis in wild, semi-wild and captive orangutans (Pongo abelii and Pongo pygmaeus) on Sumatra and Borneo, Indonesia. PLoS One. 2016;11:e0152771.View ArticleGoogle Scholar
  3. Robertson LJ, Hanevik K, Escobedo AA, Mørch K, Langeland N. Giardiasis - why do the symptoms sometimes never stop? Trends Parasitol. 2010;26:75–82.Google Scholar
  4. Zaat JO, Mank TG, Assendelft WJA. systematic review on the treatment of giardiasis. Trop Med Int Health. 1998;47:63–82.Google Scholar
  5. Berkman DS, Lescano AG, Gilman RH, Lopez SL, Black MM. Effects of stunting, diarrhoeal disease, and parasitic infection during infancy on cognition in late childhood: a follow-up study. Lancet. 2002;359:564–71.View ArticlePubMedGoogle Scholar
  6. Thompson RC, Ash A. Molecular epidemiology of Giardia and Cryptosporidium infections. Infect Genet Evol. 2016;40:315–323.Google Scholar
  7. Feng Y, Xiao L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin Microbiol Rev. 2011;24:110–40.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Laseknesselquist E, Welch DM, Sogin ML. The identification of a new Giardia duodenalis assemblage in marine vertebrates and a preliminary analysis of G. duodenalis population biology in marine systems. Int J Parasitol. 2010;40:1063–74.View ArticleGoogle Scholar
  9. Monis PT, Caccio SM, Thompson RC. Variation in Giardia: towards a taxonomic revision of the genus. Trends Parasitol. 2009;25:93–100.View ArticlePubMedGoogle Scholar
  10. Veronesi F, Piergili FD, Morganti G, Bietta A, Moretta I, Moretti A, Traversa D. Occurrence of Giardia duodenalis infection in chinchillas (Chincilla lanigera) from Italian breeding facilities. Res Vet Sci. 2012;93:807–10.View ArticlePubMedGoogle Scholar
  11. Qi M, Yu F, Li S, Wang H, Luo N, Huang J, Zhang L. Multilocus genotyping of potentially zoonotic Giardia duodenalis in pet chinchillas (Chinchilla lanigera) in China. Vet Parasitol. 2015;208:113–7.View ArticlePubMedGoogle Scholar
  12. Levecke B, Meulemans L, Dalemans T, Casaert S, Claerebout E, Geurden T. Mixed Giardia duodenalis assemblage A, B, C and E infections in pet chinchillas (Chinchilla lanigera) in Flanders (Belgium). Vet Parasitol. 2011;177:166–70.View ArticlePubMedGoogle Scholar
  13. Fernándezálvarez Á, Martínalonso A, Abreuacosta N, Feliu C, Hugot JP, Valladares B, Foronda P. Identification of a novel assemblage G subgenotype and a zoonotic assemblage B in rodent isolates of Giardia duodenalis in the Canary Islands, Spain. Parasitology. 2014;141:206–15.View ArticleGoogle Scholar
  14. Qi M, Dong H, Wang R, Li J, Zhao J, Zhang L, Luo J. Infection rate and genetic diversity of Giardia duodenalis in pet and stray dogs in Henan Province, China. Parasitol Int. 2016;65:159–62.View ArticlePubMedGoogle Scholar
  15. Zhang XX, Zheng WB, Ma JG, Yao QX, Zou Y, Bubu CJ, et al. Occurrence and multilocus genotyping of Giardia duodenalis assemblage C and D in farmed raccoon dogs, Nyctereutes procyonoides, in China. Parasit Vectors. 2016;9:471.View ArticlePubMedPubMed CentralGoogle Scholar
  16. Liu G, Su Y, Zhou M, Zhao J, Zhang T, Ahmad W, et al. Prevalence and molecular characterization of Giardia duodenalis isolates from dairy cattle in northeast China. Exp Parasitol. 2015;154:20–4.View ArticlePubMedGoogle Scholar
  17. Qi M, Zhou H, Wang H, Wang R, Xiao L, Arrowood MJ, et al. Molecular identification of Cryptosporidium spp. and Giardia duodenalis in grazing horses from Xinjiang, China. Vet Parasitol. 2015;209:169–72.View ArticlePubMedGoogle Scholar
  18. Peng XQ, Tian GR, Ren GJ, Yu ZQ, Lok JB, Zhang LX, et al. Infection rate of Giardia duodenalis, Cryptosporidium spp. and Enterocytozoon bieneusi in cashmere, dairy and meat goats in China. Infect Genet Evol. 2016; 41:26–31.Google Scholar
  19. Zhang W, Zhang X, Wang R, Liu A, Shen Y, Ling H, et al. Genetic characterizations of Giardia duodenalis in sheep and goats in Heilongjiang Province, China and possibility of zoonotic transmission. PLoS Negl Trop Dis. 2012;6:e1826.View ArticlePubMedPubMed CentralGoogle Scholar
  20. Wang R, Zhang X, Zhu H, Zhang L, Feng Y, Jian F, et al. Genetic characterizations of Cryptosporidium spp. and Giardia duodenalis in humans in Henan, China. Exp Parasitol. 2011;127:42–5.View ArticlePubMedGoogle Scholar
  21. Cacciò SM, Beck R, Lalle M, Marinculic A, Pozio E. Multilocus genotyping of Giardia duodenalis reveals striking differences between assemblages A and B. Int J Parasitol. 2008;38:1523–31.View ArticlePubMedGoogle Scholar
  22. Li W, Li Y, Song M, Lu Y, Yang J, Tao W, et al. Prevalence and genetic characteristics of Cryptosporidium, Enterocytozoon bieneusi and Giardia duodenalis in cats and dogs in Heilongjiang Province, China. Vet Parasitol. 2015;208(34):125.View ArticlePubMedGoogle Scholar
  23. Li J, Zhang P, Wang P, Alsarakibi M, Zhu H, Liu Y, et al. Genotype identification and prevalence of Giardia duodenalis in pet dogs of Guangzhou, southern China. Vet Parasitol. 2012;188:368–71.View ArticlePubMedGoogle Scholar
  24. Li W, Liu C, Yu Y, Li J, Gong P, Song M, et al. Molecular characterization of Giardia duodenalis isolates from police and farm dogs in China. Exp Parasitol. 2013;135:223–6.View ArticlePubMedGoogle Scholar
  25. Liu H, Shen Y, Liu A, Yin J, Yuan Z, Jiang Y, et al. Occurrence and multilocus genotyping of Giardia duodenalis in pets and zoo animals in Shanghai, China. J Infet Dev Ctries. 2017;11:479–86.View ArticleGoogle Scholar
  26. Lebbad M, Petersson I, Karlsson L, Botero-Kleiven S, Andersson JO, Bo S, Svärd SG. Multilocus genotyping of human Giardia isolates suggests limited zoonotic transmission and association between assemblage B and flatulence in children. PLoS Negl Trop Dis. 2011;5:e1262.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Ye J, Xiao L, Wang Y, Guo Y, Roellig DM, Feng Y. Dominance of Giardia duodenalis assemblage A and Enterocytozoon bieneusi genotype BEB6 in sheep in Inner Mongolia, China. Vet Parasitol. 2015;210:235–9.View ArticlePubMedGoogle Scholar
  28. Garcíacervantes PC, Báezflores ME, Delgadovargas F, Poncemacotela M, Nawa Y, Delacruzotero MD, et al. Giardia duodenalis genotypes among schoolchildren and their families and pets in urban and rural areas of Sinaloa, Mexico. J Infect Dev Ctries. 2017;11:180–7.View ArticleGoogle Scholar
  29. Coelho CH, Durigan M, Leal DAG, Schneider ADB, Franco RMB, Singer SM. Giardiasis as a neglected disease in Brazil: Systematic review of 20 years of publications. PloS Negl Trop Dis. 2017;11:e0006005.View ArticlePubMedPubMed CentralGoogle Scholar
  30. Meng Q, Wang H, Bo J, Wang R, Jian F, Ning C, et al. Prevalence and multilocus genotyping of Giardia duodenalis in dairy calves in Xinjiang, northwestern China. Parasit Vectors. 2016;9:546.View ArticleGoogle Scholar
  31. Zhang XX, Tan QD, Zhao GH, Ma JG, Zheng WB, Ni XT, et al. Prevalence, risk factors and multilocus genotyping of Giardia duodenalis in dairy cattle, northwest China. J Eukaryot Microbiol. 2016;63:498–504.View ArticlePubMedGoogle Scholar

Copyright

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate. Please note that comments may be removed without notice if they are flagged by another user or do not comply with our community guidelines.

Advertisement