Skip to main content
Download PDF

Stable transformation of fluorescent proteins into Nosema bombycis by electroporation

Parasites & Vectors volume 15, Article number: 141 (2022) Cite this article

Abstract

Background

Microsporidia are a group of intracellular parasitic eukaryotes, serious pathogens that cause widespread infection in humans, vertebrates, and invertebrates. Because microsporidia have a thick spore wall structure, the in vitro transformation, cell culture, and genetic operation technology of microsporidia are far behind that of other parasites.

Methods

In this study, according to an analysis of the life-cycle of microsporidia, Nosema bombycis, and different electro-transformation conditions, the transduction efficiency of introducing foreign genes into N. bombycis was systematically determined.

Results

We analyzed the direct electro-transformation of foreign genes into germinating N. bombycis using reporters under the regulation of different characteristic promoters. Furthermore, we systematically determined the efficiency of electro-transformation into N. bombycis under different electro-transformation conditions and different developmental stages through an analysis of the whole life-cycle of N. bombycis. These results revealed that foreign genes could be effectively introduced through a perforation voltage of 100 V pulsed for 15 ms during the period of N. bombycis sporeplasm proliferation.

Conclusions

We present an effective method for electro-transformation of a plasmid encoding a fluorescent protein into N. bombycis, which provides new insight for establishing genetic modifications and potential applications in these intracellular parasites.

Graphical Abstract

Background

Microsporidia are a group of obligate intracellular parasitic single-cell eukaryotes with unique biological characteristics. They can infect almost all invertebrates and vertebrates, including humans [1,2,3,4,5]. In patients with immune deficiencies, infection by microsporidia such as Enterocytozoon bieneusi, Encephalitozoon cuniculi, and Encephalitozoon intestinalis can lead to malignant diseases of the respiratory system, urinary system, and skin ulceration, which may be life-threatening [6,7,8]. Encephalitozoon cuniculi infects mice, guinea pigs, and other animals, leading to tissue lesions, brain death, and other symptoms [9,10,11]. Nosema bombycis, Vairimorpha apis, and Vairimorpha ceranae infect economically important insects, hinder their development, reduce spawning and reproduction, and eventually lead to their death and heavy economic losses [12,13,14,15]. The most effective way to control and treat microsporidia is by analyzing microsporidia–host interactions and infection mechanisms [2, 16, 17]. Changing the microsporidian genome through genetic manipulation technology is undoubtedly the most effective means to improve our understanding of the mechanism of microsporidian infection and proliferation mechanisms.

Since the completion of the detailed genome map of E. cuniculi in 2001, the genome sequences of E. bieneusi, Trichomonas hominis, V. apis, V. ceranae, and N. bombycis have been gradually completed, indicating that the microsporidia studies have entered the era of genome research [18,19,20,21]. The thickness and composition of the spore wall of microsporidia (exospore, endospore, and plasma membrane) complicate the introduction of exogenous genes into microsporidia by currently available technologies, including homologous recombination-based gene targeting, gene transposition, and CRISPR/Cas9 gene editing [5, 22, 23]. At present, the common methods used to explain microsporidia functional genes and the infection mechanism include chemical methods such as fluorescent probe-labeling, biotin-labeling, antibody-labeling, or chemical reagent fluorescent brightener 28 (FB28), and 4′,6-diamidino-2-phenylindole (DAPI) nuclear dye [24,25,26,27]. Furthermore, although it has been reported that RNA interference (RNAi) can inhibit microsporidia gene expression, the interference efficiency is not high, and it is difficult to carry out systematic gene function research [28, 29]. Therefore, a method for introducing foreign genes into microsporidia is urgently needed to provide a basis for gene function research, prevention, and control of microsporidia.

Electro-transformation is an effective artificial transformation method that introduces natural or recombinant foreign protein-encoding genes into microorganisms for overexpression or homologous recombination for gene knockout or knock-in [30, 31]. It is widely used in the directional transformation of fungi and bacterial strains [32, 33]. Since 1993, foreign gene vectors have been introduced by electro-transformation into Toxoplasma gondii for stable and efficient expression, and then into Plasmodium falciparum, Cryptosporidium parvum, and Eimeria intestinalis [34,35,36]. The transformation efficiency of electro-transformation is affected by the growth stage of the parasite, components of the shock buffer, shock voltage, pulse time, electric field strength, resistance, plasmid DNA concentration, components of resuscitation medium, and the resuscitation time [32, 37]. At present, there is still no report of the introduction of foreign genes in microsporidia by electric transformation. Therefore, the establishment of such a method is crucial to providing key technical means for analyzing the mechanisms underlying the infection of microsporidia and the interaction between the pathogen and the host.

Microsporidia species have the smallest known eukaryotic genome. Such compactness needs to be investigated and may provide an experimental advantage [20]. Based on the previous experience of successful in vivo transformation in parasites, when designing a successful in vivo gene transformation method of N. bombycis, we first analyzed the efficiency of fluorescent protein expression by the original Bombyx mori A3 cytoplasmic actin promoter (A3) and Orgyia pseudotsugata multiple nucleocapsid nuclear polyhedrosis virus immediate-early 2 gene (OpIE2) promoter. Then, the N. bombycis transduction efficiency was explored according to the previously reported electro-transformation strategy. Finally, based on the analysis of the life history of N. bombycis, we discuss the best conditions for the electro-transformation of foreign genes into N. bombycis. The successful introduction of a fluorescent protein gene by electro-transformation undoubtedly allows foreign gene recombination, gene fusion expression, nonhomologous end joining, and gene editing in the N. bombycis genome.

Methods

Cells and N. bombycis

Bombyx mori embryo (BmE-SWU1) and Bombyx mori ovary (BmN-SWU1) cells were established and preserved in our laboratory [38, 39]. In addition, the N. bombycis CQ1 [no.: CVCC3088(L)] was isolated and preserved in our laboratory.

Vector construction

The plasmid pBac-A3prm-enhanced green fluorescent protein (EGFP) and pIZ-OpIE2prm-Discosoma sp. red fluorescent protein (DsRed) was constructed by our laboratory. Briefly, the DsRed fragments were amplified using the primers DsRed-F: CCCAAGCTTATGGCCTCCTCCGAGAACGT and DsRed-R: CGGGGTACCCAGGAACAGGTGGTGGCGG. Subsequently, the polymerase chain reaction (PCR) fragments were connected to a pIZ-V5/His vector to generate pIZ-OpIE2prm-DsRed. The plasmids pBac-A3prm-EGFP were constructed using the B. mori cytoplasmic actin gene BmA3 promoter and the enhanced green fluorescent protein (EGFP) sequence, in addition to the SV40 polyadenylation signal sequence as described previously [40].

Immunofluorescence

The microsporidia localization at different infection times was analyzed by immunofluorescence after infection of BmN-SWU1 and BmE-SWU1 cells with N. bombycis. Briefly, the sample was washed with phosphate-buffered saline (PBS), and 500 µl of 4% paraformaldehyde was then added to each well and left at room temperature for 15 min. After washing with PBS, 500 µl of 1% Triton X-100 was added and the sample was left at room temperature for 10 min, then incubated at 37 °C for 1 h. Finally, the samples were incubated with anti-PTP2 antibody (1:200, rabbit), incubated at 37 °C for 1 h, and then incubated with Alexa 488-conjugated goat anti-rabbit secondary antibody (1:1000) at 37 °C for 1 h. The nuclei-stained microsporidia were incubated with FB28 at 37 °C for 1 h. An Olympus FV3000 scanning electron microscope was used for image acquisition. Excitation wavelengths of 405, 488, and 561 nm were used for all the images.

Electroporation of N. bombycis

Four hundred microliters of 1 M sorbitol and 5 µg of plasmid were added to a solution containing 1 × 107 spores, then resuspended and mixed evenly, precooled on ice for 10 min, transferred to a precooled electrode cup, and left there for 5 min. The electric shock parameters were set, the shock was applied, the sample was left standing for 3 min and then washed, and BmN-SWU1 and BmE-SWU1 cells were then infected after 0.1 M KOH treatment. The electroporation system (CUY21EDIT II) was purchased from BEX Japan.

Electroporation of cells

The BmN-SWU1 and BmE-SWU1 cells were collected in a 5 ml centrifuge tube and centrifuged at 800×g for 5 min, and the supernatant was removed. Next, 3 ml Opti-MEM (minimal essential medium) was added, the cells were centrifuged for 800×g for 5 min, and the supernatant was removed. Then, 25 µl of medium (cell content ≥ 1 × 106) and 5 µg of plasmid were added, and the mix was transferred to a 2 mm electrode cup. Finally, the electro-transformation parameters were set, and the cells were electroporated and left to recover for 1 min. After electroporation, 200 µl of Opti-MEM medium were added to the electrode cup, and the cell suspension was transferred to 24-well plates. The cells were cultured at 27 °C, and the expression of the transformation plasmid was observed for 24 h.

Statistical analysis

All of the statistical analysis was performed using Student’s t-test in GraphPad Prism 6 (http://www.graphpad.com) (GraphPad Software, Inc., San Diego, CA, USA). All the data are presented as the mean ± SD. Differences between groups were considered significant at the following significance levels, **P < 0.01.

Results

Plasmid transfection into N. bombycis-infected cells

To analyze the expression of fluorescent protein after BmE-SWU1 cell infection with microsporidia, the B. mori actin 3 (A3) promoter and baculovirus Orgyia pseudotsugata multi nucleocapsid nuclear polyhedrosis virus (OpMNPV) OpIE2 promoter were selected to construct fluorescent protein expression vectors (Fig. 1a).

Fig. 1
figure 1

Transfection of plasmids into N. bombycis-infected cells. a Top: Schematic diagrams of the EGFP protein expression vector construction. In the plasmids used for transient expression in microsporidia, GFP was driven by the A3promoter. Bottom: Green fluorescence observation of liposome-transfected pBac-A3prm-EGFP plasmid into microsporidia-infected cells. Scale bar, 3 μm. b Top: Schematic diagrams of the DsRed protein expression vector construction. In the plasmids used for transient expression in microsporidia, DsRed was driven by the OpIE2 promoter. Bottom: Red fluorescence observation of liposome-transfected pIZ-OpIE2prm-DsRed plasmid into microsporidia-infected cells

Full size image

Since the best time for introducing a foreign gene into N. bombycis is unclear, multiple transfection at different times was performed to observe fluorescent protein expression. The silkworm cells were infected with microsporidia after transfection with fluorescent protein expression plasmid, and the fluorescent protein expression was observed at 96 h post–infection (p.i.). The expression of the red fluorescence and green fluorescence was clearly observable after transfection with pBac-A3prm-EGFP and pIZ-OpIE2prm-DsRed of N. bombycis-infected cells. In addition, the A3 and OpIE2 promoter expression vector could enter N. bombycis and express the fluorescent protein (Fig. 1b).

Electro-transformation of fluorescent protein into N. bombycis spores

To obtain high fluorescence intensity trace-N. bombycis, we attempted to electro-transform N. bombycis with a fluorescent protein-encoding plasmid. We analyzed the germination of N. bombycis with different electro-transformation parameters. Different electro-transformation conditions had some effects on the germination of N. bombycis, but all of them could normally germinate (Fig. 2a). Notably, the germination rate of N. bombycis was relatively high under the condition of 2.5 kV, 200 Ω, and 25 µF electric transformation (Table 1). Therefore, BmN-SWU1 cells were infected with N. bombycis under this electric-transformation condition (Fig. 2b). However, the expression of fluorescent protein could not be detected in N. bombycis. These results showed that the electro-transformation of N. bombycis could not introduce the plasmid into N. bombycis.

Fig. 2
figure 2

Electro-transformation of fluorescent protein into N. bombycis. a Artificial germination of N. bombycis. b Fluorescence analysis of fluorescent protein expression in BmN-SWU1 cell infection with N. bombycis after electro-transformation. Scale bar, 1 and 2 μm

Full size image
Table 1 Germination of microsporidia for different electroporation parameters
Full size table

Tolerance of BmN-SWU1 and BmE-SWU1 cells to electro-transformation

Electro-transformation can electroporate the cell membrane, allowing the plasmid to enter the cell membrane instantaneously [33, 41]. Therefore, we carried out an electro-transformation experiment of microsporidia at the cellular level. The pIZ-OpIE2prm-DsRed plasmids were electro-transformed into the two cell lines. The results showed that under the same electro-transformation parameters, the BmE-SWU1 cell line had higher expression of the fluorescent protein than BmN-SWU1. Meanwhile, perforation voltage 100 V, pulse length 15 ms, pulse interval 10 ms, drive voltage 25 V, pulse length 60 ms, pulse interval 50 ms, and 10 cycles were the best electro-transformation conditions in perforation electrophoresis (Table 2).

Table 2 Parameter settings for Bombyx mori cell by electro-transformation
Full size table

Analysis of N. bombycis life history in BmN-SWU1 cells

To determine the best electro-transformation period, we labeled the polar tube protein NbPTP2 and nuclear state during N. bombycis infection by immunofluorescence. Nosema bombycis ejected polar filaments to infect host cells, and NbPTP2 could be labeled after 3 h p.i. At 9–21 h p.i., the period of schizont N. bombycis with obvious membranc lysis could be observed (Fig. 3). At 48–72 h p.i., the form of binuclear and polynuclear of N. bombyxcis were stained by DAPI.  There was no sporoblast during at this time. It is speculated that the sporoblast began to develop 48–72 h p.i. At 96 h p.i., the spores entered host cells by ejecting polar filaments (Fig. 3). These results showed that 3–72 h p.i. is the critical period for N. bombycis proliferation, and an important period of electrical transformation.

Fig. 3
figure 3

Analysis of N. bombycis life history in BmE-SWU1 cells. Immunofluorescence localization of NbPTP2 in N. bombycis infection. Green represents NbPTP2 protein expression; DAPI represents the nucleus of B. mori and N. bombycis. Scale bar, 5 μm

Full size image

Transfection of N. bombycis for stable expression of fluorescent protein

Based on the life history of N. bombycis infections, we selected 9 h, 21 h, and 48 h after infection for the electro-transformation experiment. We introduced pBac-A3prm-EGFP and pIZ-OpIE2prm-DsRed plasmids into the BmE-SWU1 cell line by electro-transformation. The green fluorescence proteins could be detected at 9 h p.i., 21 h p.i., and 48 h p.i., which indicates that the best period for foreign gene introduction is in the sporoplasm and sporogony stage of N. bombycis (Fig. 4a and b). It is speculated that N. bombycis has only one plasma membrane in the intracellular stage at 9–48 h p.i. Therefore, the foreign gene could easily enter N. bombycis by electro-transformation. Fluorescence observation also showed that regardless of the period of electro-transformation, the fluorescence signal could be detected at 84 h p.i. We further analyzed whether N. bombycis with fluorescent proteins could proliferate in BmE-SWU1 cells. The results showed that the fluorescence signal of several spores could be detected in a single image (Fig. 4c and d).

Fig. 4
figure 4

Transfection of the N. bombycis for stable expression of a fluorescent protein. Fluorescence analysis of N. bombycis-infected cells electro-transformed with plasmids. a Green represents green fluorescent protein expression; b Red represents red fluorescent protein expression. Scale bar, 3 μm. c Green represents green fluorescent protein expression. d Red represents red fluorescent protein expression. DAPI represents the nucleus of B. mori and N. bombycis. Scale bar, 3 μm

Full size image

Discussion

Microsporidia, a large class of unicellular eukaryotes with typical obligate intracellular parasitism, have been identified in more than 200 genera and 1500 species [42]. However, up to now, there have been no reports of gene mutation, genome deletion, or fusion expression of foreign genes in microsporidia, which seriously affects the interpretation of the microsporidian development cycle and the analysis of the infection mechanism. To overcome these challenges, in this study we successfully introduced genes encoding foreign fluorescent proteins into microsporidia by electro-transformation, and systematically analyzed the electro-transformation conditions and best opportunity for foreign gene introduction.

Microsporidia are unique intracellular parasites. The introduction of foreign genes into infected BmN-SWU1 through non-transposon vectors and the attempt to culture N. bombycis in vitro could not efficiently introduce foreign genes into the parasite [14, 43]. As an important transformation technology in molecular biology, electro-transformation has the advantages of a wide application range, high transformation efficiency, and simple operation [31,32,33]. It can be applied to microbial genetic engineering, mutation breeding, exogenous expression of related proteins, and directional transformation of strains [37, 39]. Therefore, this study attempted to introduce foreign genes into microsporidia through electro-transformation. We first tried direct electro-transformation of the N. bombycis, but no stable expression of foreign genes was reached. Given what is known about electrical transformation in Plasmodium and Cryptosporidium, we speculate that failure to transform the germinated microsporidia may be because, during this period, the spore protoplasm is not completely exposed to the culture medium, and the culture medium is not suitable for N. bombycis (Fig. 2) [35, 44, 45]. Exploring the electro-transformation methods in N. bombycis and the culture conditions is suitable for the proliferation of N. bombycis [45]. Therefore, we further analyzed the intracellular electro-transformation at different stages after infecting cells with N. bombycis and determined that the schizogony of N. bombycis was the key period for electro-transformation (Fig. 3). These results verified the electro-transformation conditions of microsporidia, which proved that changing the permeability level of the membrane could transform foreign genes more effectively and confirmed that foreign genes could not be effectively introduced during spore germination and mature spore morphology (Fig. 5).

Fig. 5
figure 5

Schematic diagram illustrating the high-efficiency transformation of fluorescent proteins into N. bombycis

Full size image

Expression of fluorescent marker genes, homologous repair, gene design, anti-drug screening, gene knockout, and CRISPR library screening have been widely used in Toxoplasma gondii after transient transformation and expression of foreign genes based on electro-transformation [34, 46,47,48]. Therefore, based on the electro-transformation method, we can carry out further studies in microsporidia, as described in the following three examples: (1) According to the previous studies on methionine amino-peptidase (MetAP2)-resistant fumagillin, we could express fluorescent protein fusion resistance markers to screen the strains stably expressing the fluorescent proteins [45, 49]. (2) A long terminal direct repeat retrotransposon (LTR) transposon and a Tc1-like DNA transposon have been reported in the N. bombycis genome, and PiggyBac transposon could also be transposed in the genome of P. falciparum [45, 50,51,52]. Therefore, we could combine fluorescent protein, resistance marker, and transposon to transform foreign genes into the N. bombycis genome through electrical transformation. (3) CRISPR/Cas9 genome editing techniques are a powerful tool developed for many intracellular parasites. It is not difficult to imagine that genetic manipulation mediated by CRISPR will also be applied to the genome of microsporidia parasites as these techniques improve [46, 47]. It was previously reported that after inducing spore germination in vitro, the sporoplasm of N. bombycis was successfully isolated and identified [53, 54]. Combined with electro-transformation technology, it may be more efficient to introduce foreign genes in N. bombycis, which will enable rapid development in the genetic operation of N. bombycis.

Conclusions

In conclusion, we systematically analyzed a method for successfully transforming exogenous genes into N. bombycis. In this study, we determined the conditions of punctured voltage, pulse length, and pulse interval, and we found that the schizogony period of N. bombycis is the best for a successful transformation. These results provide important insights for the development and application of N. bombycis genetic modification techniques.

Availability of data and materials

Data supporting the results of this study are included within the article.

All data and materials are fully available without restriction upon reasonable request.

Abbreviations

A3:

Bombyx mori A3 cytoplasmic actin promoter

OpIE2:

Orgyia pseudotsugata multiple nucleocapsid nuclear polyhedrosis virus immediate-early 2 gene

CRISPR/Cas9:

Clustered regularly interspaced short palindromic repeats/CRISPR-associated 9

kV:

Kilovolt

Ω:

Ohms

µF:

Microfarad

BmE-SWU1:

Bombyx mori embryo Southwest University 1

BmN-SWU1:

Bombyx mori ovary Southwest University 1

DNA:

Deoxyribonucleic acid

EGFP:

Enhanced green fluorescent protein

DsRed:

Discosoma sp. red fluorescent protein

PBS:

Phosphate-buffered saline

References

  1. Arneodo JD, Sciocco-Cap A. Biological and molecular features of Nosema rachiplusiae sp. n., a microsporidium isolated from the neotropical moth Rachiplusia nu (Guenee) (Lepidoptera: Noctuidae). Parasitol Res. 2018;117:1325–31.

    Article  PubMed  Google Scholar 

  2. Ismail KA, Hawash YA, Saber T, Eed EM, Khalifa AS, Alsharif KF, et al. Microsporidia infection in patients with autoimmune diseases. Indian J Med Microbi. 2020;38:409–14.

    Article  Google Scholar 

  3. Becnel JJ, White SE, Shapiro AM. Review of microsporidia-mosquito relationships: from the simple to the complex. Folia Parasitol. 2005;52:41–50.

    Article  Google Scholar 

  4. Bhat SA. Histopathology in the gut of silkworm, Bombyx mori Linn. infected with microsporidia. Appl Biol Res. 2021;23:107–9.

    Article  Google Scholar 

  5. Weber R, Bryan RT, Schwartz DA, Owen RL. Human microsporidial infections. Clin Microbiol Rev. 1994;7:426–61.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Chavant P, Taupin V, El Alaoui H, Wawrzyniak I, Chambon C, Prensier G, et al. Proteolytic activity in Encephalitozoon cuniculi sporogonial stages: predominance of metallopeptidases including an aminopeptidase-P-like enzyme. Int J Parasitol. 2005;35:1425–33.

    Article  CAS  PubMed  Google Scholar 

  7. Bohne W, Bottcher K, Gross U. The parasitophorous vacuole of Encephalitozoon cuniculi: biogenesis and characteristics of the host cell-pathogen interface. Int J Med Microbiol. 2011;301:395–9.

    Article  CAS  PubMed  Google Scholar 

  8. Ouarzane-Amara M, Franetich JF, Mazier D, Pettit GR, Meijer L, Doerig C, et al. In vitro activities of two antimitotic compounds, pancratistatin and 7-deoxynarciclasine, against Encephalitozoon intestinalis, a microsporidium causing infections in humans. Antimicrob Agents Chemother. 2001;45:3409–15.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Zasukhin DN, Viting AI, Kaliakin VN. Transplacental transmission of Encephalitozoon (Nosema) cuniculi in mice. Med Parazitol (Mosk). 1968;37:663–6.

    CAS  Google Scholar 

  10. Niederkorn JY, Shadduck JA, Schmidt EC. Susceptibility of selected inbred strains of mice to Encephalitozoon cuniculi. J Infect Dis. 1981;144:249–53.

    Article  CAS  PubMed  Google Scholar 

  11. Deplazes P, Mathis A, Muller C, Weber R. Molecular epidemiology of Encephalitozoon cuniculi and first detection of Enterocytozoon bieneusi in faecal samples of pigs. J Eukaryot Microbiol. 1996;43:93S.

    Article  CAS  PubMed  Google Scholar 

  12. Pocco ME, De Wysiecki ML, Lange CE. Infectivity of Paranosema locustae (Microsporidia) against gregarious-phase South American locust (Orthoptera) when treated en masse. J Invert Pathol. 2020;177:107504.

    Article  Google Scholar 

  13. Zhang L, Lecoq M. Nosema locustae (Protozoa, Microsporidia), a biological agent for Locust and Grasshopper control. Agronomy-Basel. 2021;11:711.

    Article  CAS  Google Scholar 

  14. Gisder S, Mockel N, Linde A, Genersch E. A cell culture model for Nosema ceranae and Nosema apis allows new insights into the life cycle of these important honey bee-pathogenic microsporidia. Environ Microbiol. 2011;13:404–13.

    Article  CAS  PubMed  Google Scholar 

  15. Czekonska K. Influence of carbon dioxide on Nosema apis infection of honeybees (Apis mellifera). J Invertebr Pathol. 2007;95:84–6.

    Article  PubMed  Google Scholar 

  16. Katznelson H, Jamieson CA. Control of nosema disease of honeybees with fumagillin. Science. 1952;115:70–1.

    Article  CAS  PubMed  Google Scholar 

  17. Nanetti A, Ugolini L, Cilia G, Pagnotta E, Malaguti L, Cardaio I, et al. Seed meals from Brassica nigra and Eruca sativa control artificial Nosema ceranae infections in Apis mellifera. Microorganisms. 2021;9:949.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Thomarat F, Vivares CP, Gouy M. Phylogenetic analysis of the complete genome sequence of Encephalitozoon cuniculi supports the fungal origin of microsporidia and reveals a high frequency of fast-evolving genes. J Mol Evol. 2004;59:780–91.

    Article  CAS  PubMed  Google Scholar 

  19. Williams BA, Lee RC, Becnel JJ, Weiss LM, Fast NM, Keeling PJ. Genome sequence surveys of Brachiola algerae and Edhazardia aedis reveal microsporidia with low gene densities. BMC Genomics. 2008;9:200.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Pan G, Xu J, Li T, Xia Q, Liu SL, Zhang G, et al. Comparative genomics of parasitic silkworm microsporidia reveal an association between genome expansion and host adaptation. BMC Genomics. 2013;14:186.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Chen Y, Pettis JS, Zhao Y, Liu X, Tallon LJ, Sadzewicz LD, et al. Genome sequencing and comparative genomics of honey bee microsporidia, Nosema apis reveal novel insights into host-parasite interactions. BMC Genomics. 2013;14:451.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Wu Z, Li Y, Pan G, Zhou Z, Xiang Z. SWP25, a novel protein associated with the Nosema bombycis endospore. J Eukaryot Microbiol. 2009;56:113–8.

    Article  CAS  PubMed  Google Scholar 

  23. Miao Z, Zhang P, Zhang Y, Huang X, Liu J, Wang G. Single-cell analysis reveals the effects of glutaraldehyde and formaldehyde on individual Nosema bombycis spores. Analyst. 2019;144:3136–43.

    Article  CAS  PubMed  Google Scholar 

  24. Oguz Kaya I, Dogruman Al F, Mumcuoglu I. Investigation of Microsporidia prevalence with calcofluor white and uvitex 2B chemiluminescence staining methods and molecular analysis of species in diarrheal patients. Mikrobiyol Bul. 2018;52:401–12.

    Article  PubMed  Google Scholar 

  25. Mohammed H, Endeshaw T, Kebede A, Defera M. Comparison of Chromotrope 2R and Uvitex 2B for the detection of intestinal microsporidial spores in stool specimens of HIV patients attending Nekempte Hospital, West Ethiopia. Ethiop Med J. 2009;47:233–7.

    PubMed  Google Scholar 

  26. Chen J, Guo W, Dang X, Huang Y, Liu F, Meng X, et al. Easy labeling of proliferative phase and sporogonic phase of microsporidia Nosema bombycis in host cells. PLoS ONE. 2017;12:e0179618.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Ahmed NH, Caffara M, Sitja-Bobadilla A, Fioravanti ML, Mazzone A, Aboulezz AS, et al. Detection of the intranuclear microsporidian Enterospora nucleophila in gilthead sea bream by in situ hybridization. J Fish Dis. 2019;42:809–15.

    Article  CAS  PubMed  Google Scholar 

  28. He N, Zhang Y, Duan XL, Li JH, Huang WF, Evans JD, et al. RNA interference-mediated knockdown of genes encoding spore wall proteins confers protection against Nosema ceranae infection in the European Honey Bee, Apis mellifera. Microorganisms. 2021;9:505.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Huang Y, Zheng S, Mei X, Yu B, Sun B, Li B, et al. A secretory hexokinase plays an active role in the proliferation of Nosema bombycis. PeerJ. 2018;6:e5658.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Teughels W, Sliepen I, De Keersmaecker S, Quirynen M, Lippmann J, Pauwels M, et al. Influence of genetic background on transformation and expression of Green Fluorescent Protein in Actinobacillus actinomycetemcomitans. Oral Microbiol Immunol. 2005;20:274–81.

    Article  CAS  PubMed  Google Scholar 

  31. Cao G, Zhang X, Zhong L, Lu Z. A modified electro-transformation method for Bacillus subtilis and its application in the production of antimicrobial lipopeptides. Biotechnol Lett. 2011;33:1047–51.

    Article  CAS  PubMed  Google Scholar 

  32. Cruz-Ramon J, Fernandez FJ, Fierro F. High-Efficiency Electroporation for Genetic Improvement of Fungal Strains. Methods Mol Biol. 2021;2296:185–94.

    Article  CAS  PubMed  Google Scholar 

  33. Garcia PA, Ge Z, Kelley LE, Holcomb SJ, Buie CR. High efficiency hydrodynamic bacterial electrotransformation. Lab Chip. 2017;17:490–500.

    Article  CAS  PubMed  Google Scholar 

  34. Donald RG, Roos DS. Stable molecular transformation of Toxoplasma gondii: a selectable dihydrofolate reductase-thymidylate synthase marker based on drug-resistance mutations in malaria. Proc Natl Acad Sci USA. 1993;90:11703–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Wu Y, Kirkman LA, Wellems TE. Transformation of Plasmodium falciparum malaria parasites by homologous integration of plasmids that confer resistance to pyrimethamine. Proc Natl Acad Sci USA. 1996;93:1130–4.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. He L, Feng J, Lu S, Chen Z, Chen C, He Y, et al. Genetic transformation of fungi. Int J Dev Biol. 2017;61:375–81.

    Article  CAS  PubMed  Google Scholar 

  37. Chakraborty BN, Patterson NA, Kapoor M. An electroporation-based system for high-efficiency transformation of germinated conidia of filamentous fungi. Can J Microbiol. 1991;37:858–63.

    Article  CAS  PubMed  Google Scholar 

  38. Pan MH, Xiao SQ, Chen M, Hong XJ, Lu C. Establishment and characterization of two embryonic cell lines of Bombyx mori. In Vitro Cell Dev Biol Anim. 2007;43:101–4.

    Article  CAS  PubMed  Google Scholar 

  39. Pan MH, Cai XJ, Liu M, Lv J, Tang H, Tan J, et al. Establishment and characterization of an ovarian cell line of the silkworm, Bombyx mori. Tissue Cell. 2010;42:42–6.

    Article  CAS  PubMed  Google Scholar 

  40. Tamura T, Thibert C, Royer C, Kanda T, Abraham E, Kamba M, et al. Germline transformation of the silkworm Bombyx mori L. using a piggyBac transposon-derived vector. Nat Biotechnol. 2000;18:81–4.

    Article  CAS  PubMed  Google Scholar 

  41. Liu F, Heston S, Shollenberger LM, Sun B, Mickle M, Lovell M, et al. Mechanism of in vivo DNA transport into cells by electroporation: electrophoresis across the plasma membrane may not be involved. J Gene Med. 2006;8:353–61.

    Article  PubMed  Google Scholar 

  42. Weiss LM, Becnel JJ. Microsporidia : pathogens of opportunity. 1st ed. Ames: Wiley Blackwell; 2014.

    Google Scholar 

  43. Guo R, Cao G, Lu Y, Xue R, Kumar D, Hu X, et al. Exogenous gene can be integrated into Nosema bombycis genome by mediating with a non-transposon vector. Parasitol Res. 2016;115:3093–8.

    Article  PubMed  Google Scholar 

  44. Rochelle PA, Marshall MM, Mead JR, Johnson AM, Korich DG, Rosen JS, et al. Comparison of in vitro cell culture and a mouse assay for measuring infectivity of Cryptosporidium parvum. Appl Environ Microbiol. 2002;68:3809–17.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  45. Reinke AW, Troemel ER. The development of genetic modification techniques in intracellular parasites and potential applications to microsporidia. PLoS Pathog. 2015;11:e1005283.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  46. Markus BM, Boydston EA, Lourido S. CRISPR-mediated transcriptional repression in Toxoplasma gondii. mSphere. 2021;6:e0047421.

    Article  PubMed  Google Scholar 

  47. Sidik SM, Hackett CG, Tran F, Westwood NJ, Lourido S. Efficient genome engineering of Toxoplasma gondii using CRISPR/Cas9. PLoS ONE. 2014;9:e100450.

    Article  PubMed  PubMed Central  Google Scholar 

  48. Zheng J, Jia H, Zheng Y. Knockout of leucine aminopeptidase in Toxoplasma gondii using CRISPR/Cas9. Int J Parasitol. 2015;45:141–8.

    Article  CAS  PubMed  Google Scholar 

  49. Upadhya R, Zhang HS, Weiss LM. System for expression of microsporidian methionine amino peptidase type 2 (MetAP2) in the yeast Saccharomyces cerevisiae. Antimicrob Agents Chemother. 2006;50:3389–95.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  50. Desjardins CA, Sanscrainte ND, Goldberg JM, Heiman D, Young S, Zeng Q, et al. Contrasting host-pathogen interactions and genome evolution in two generalist and specialist microsporidian pathogens of mosquitoes. Nat Commun. 2015;6:7121.

    Article  CAS  PubMed  Google Scholar 

  51. Song H, Tang X, Lan L, Zhang X, Zhang X. The genomic survey of Tc1-like elements in the silkworm microsporidia Nosema bombycis. Acta Parasitol. 2020;65:193–202.

    Article  CAS  PubMed  Google Scholar 

  52. Wang M, Xu JS, Wang LL, Zhang XY, Zhou XY. Pathogenicity and genetic divergence of two isolates of microsporidia Nosema bombycis. Yi Chuan. 2009;31:1121–6.

    Article  CAS  PubMed  Google Scholar 

  53. He Q, Luo J, Xu JZ, Meng XZ, Pan GQ, Li T, et al. In-vitro cultivation of Nosema bombycis sporoplasms: a method for potential genetic engineering of microsporidia. J Invertebr Pathol. 2020;174:107420.

    Article  CAS  PubMed  Google Scholar 

  54. Han B, Moretto M, Weiss L. Encephalitozoon: tissue culture, cryopreservation, and murine infection. Curr Protoc Microbiol. 2019;52:e72.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript.

Funding

This study was funded by the National Natural Science Foundation of China (Grant Nos. 31902214, 31872427, and 32060777), the Natural Science Foundation of Chongqing (cstc2019jcyj-msxmX0096 and cstc2020jscx-msxmX0045), and the China Agriculture Research System of MOF and MARA.

Author information

Author notes

  1. Zhanqi Dong and Boyuan Deng contributed equally to this work

Authors and Affiliations

  1. State Key Laboratory of Silkworm Genome Biology, Southwest University, Chongqing, 400716, China

    Zhanqi Dong, Na Gao, Boyuan Deng, Xuhua Huang, Congwu Hu, Peng Chen, Qin Wu, Cheng Lu & Minhui Pan

  2. Key Laboratory of Sericultural Biology and Genetic Breeding, Ministry of Agriculture, Southwest University, Chongqing, 400716, China

    Zhanqi Dong, Peng Chen, Cheng Lu & Minhui Pan

  3. The General Extension Station of Sericulture Technology of Guangxi Zhuang Autonomous Region, Nanning, 530007, China

    Xuhua Huang

Authors
  1. Zhanqi Dong
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Na Gao
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Boyuan Deng
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Xuhua Huang
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Congwu Hu
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Peng Chen
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Qin Wu
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Cheng Lu
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Minhui Pan
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

ZD, NG, and BD performed vector cloning, sequencing, cell culturing, and PCR. QW, CH, and XH participated in immunofluorescence and electro-transformation assays. ZD, MP, and CL conceived the experimental design and participated in data analysis. ZD, MP, PC, and CL were involved in the preparation of the manuscript. The final manuscript was reviewed by all the authors. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Cheng Lu or Minhui Pan.

Ethics declarations

Ethics approval and consent to participate

The collection of N. bombycis and silkworm specimens during the study was approved by the State Key Laboratory of Silkworm Genome Biology at Southwest University in Chongqing, China.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Dong, Z., Gao, N., Deng, B. et al. Stable transformation of fluorescent proteins into Nosema bombycis by electroporation. Parasites Vectors 15, 141 (2022). https://doi.org/10.1186/s13071-022-05236-4

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13071-022-05236-4

Keywords

Parasites & Vectors

ISSN: 1756-3305

Contact us