Open Access

Prevalence and multilocus genotyping of Giardia duodenalis in pigs of Shaanxi Province, northwestern China

  • Sha-Sha Wang1,
  • Ya-Jie Yuan1,
  • Yan-Ling Yin1,
  • Rui-Si Hu1,
  • Jun-Ke Song1 and
  • Guang-Hui Zhao1Email author
Parasites & Vectors201710:490

https://doi.org/10.1186/s13071-017-2418-8

Received: 15 May 2017

Accepted: 3 October 2017

Published: 17 October 2017

Abstract

Background

Giardiasis, caused by Giardia duodenalis (syn. Giardia intestinalis, Giardia lamblia), is a significant zoonotic parasitic disease of animals and humans worldwide. Accurate genotyping of G. duodenalis is essential for efficient control and management of giardiasis. The objectives of the present study were to investigate the prevalence and assemblages of giardiasis in pigs in Shaanxi Province, northwestern China, and for the first time study multilocus genotypes (MLGs) in pigs using multilocus genotyping technology in this region.

Results

Of 560 faecal samples collected from five farms in Shaanxi Province, 45 were positive for G. duodenalis and significant differences in prevalence were observed among different locations. Differences in prevalence were also detected in pigs of different age groups, with the highest prevalence in sows and the lowest in boars. Two assemblages, A and E, were identified, and a mixed infection of both A and E was identified in one faecal sample. Assemblage E was predominant and widely distributed in all investigated areas and age groups. Genetic viability was detected for both assemblages, and four different multi-locus genotypes (MLGs) within assemblage E were found, MLGE1-MLGE4.

Conclusions

Giardia duodenalis was detected in pigs from Shaanxi Province, northwestern China, and genetic diversity was observed in these infections. Both assemblages A and E were detected, and four distinct MLGs within assemblage E were identified. These findings provide new data for controlling G. duodenalis infection in pigs.

Keywords

Giardia duodenalis PrevalenceMLGPigShaanxi ProvinceChina

Background

Giardia duodenalis (syn. Giardia intestinalis, Giardia lamblia), an important parasitic protozoan, inhabits the gastrointestinal tracts of animals. It causes giardiasis, with clinical presentations ranging from chronic to acute diarrhea, dehydration, abdominal pain, nausea, vomiting, and weight loss [1], leading to large economic impacts [2]. Giardiasis is mainly transmitted through the faecal-oral route (e.g. water or food) [3]. The public health impact of giardiasis is significant because of its tendency to cause major outbreaks and its adverse effects on growth and cognitive functions in children [4, 5]. Giardia duodenalis has also been reported in a wide variety of other hosts worldwide, including sheep, goats, cattle, and non-human primates [620].

Recent molecular analysis indicated eight major morphologically similar but genetically distinct assemblages of G. duodenalis, assemblages A-H [21]. Among them, assemblages A and B have been identified in both humans and animals [13], whereas the remaining six assemblages (C–H) infect non-human hosts; however, assemblages C, D, E, and F have also been identified in humans [2, 22].

In China, G. duodenalis has been identified in sheep (4.3–6.6%) [15, 16], goats (2.9–12.7%) [16, 17] and cattle (1.1–60.1%) [1921]. Although most infections were asymptomatic, cysts excreted in faeces could be a possible source of infection for humans and other animals [23]. Pigs are an economically important food animal, providing pork to many nations, and pig manure is sometimes used in the cultivation of food and feed crops [24]. Giardia duodenalis infection has been reported in pigs in many countries (Table 1), with the zoonotic assemblages A and B have been detected in pigs [25], suggesting that pigs may be a reservoir of human infection. China is recognized as the largest pig breeding country in the world, with about 667 million pigs produced annually, however, prior to the present study, no public reports on G. duodenalis infection in pigs of China were available.
Table 1

Global prevalence of Giardia duodenalis infection in pigs

Country (City)

No. examined

Prevalence (%)

Locus

Detection method

Time tested (year)

Reference

Australia (unknown)

289

31.1

SSU rRNA

PCR

2005–2006

[41]

Canada (Edward)

633

1.0

SSU rRNA, bg

Immunofluorescence microscopy and PCR

2007

[48]

Canada (Ontario)

122

66.4

SSU rRNA, bg

Immunofluorescence microscopy and PCR

2005–2006

[42]

Canada (unknown)

236

9.0

a

Immunofluorescence microscopy

1995

[54]

Cambodia (Preah Vihear)

76

0

SSU rRNA

Immunofluorescence microscopy and PCR

2012

[49]

China (Shaanxi)

560

8

bg, tpi, gdh

PCR

2016–2017

This study

Denmark (unknown)

1237

17.4

a

Immunofluorescence microscopy

2003–2004

[43]

Denmark (unknown)

856

14.0

SSU rRNA, gdh

Immunofluorescence microscopy and PCR

2011–2012

[44]

Denmark (unknown)

1237

17.4

SSU rRNA, gdh

PCR

2003–2004

[45]

Turkey (Istanbul)

238

3.7

a

Immunofluorescence microscopy

2005

[50]

Norway (unknown)

684

1.5

SSU rRNA

Immunofluorescence microscopy and PCR

2004–2005

[51]

Poland (unknown)

84

9.5

bg

Immunofluorescence microscopy and PCR

2013–2014

[46]

UK (Preston, Cheshire)

7

57.1

SSU rRNA

PCR

2007–2008

[47]

USA (Ohio)

325

7.4

a

Immunofluorescence microscopy

1993

[52]

Zambia (Lusaka)

217

12.0

a

Immunofluorescence microscopy

2011

[25]

aPCR not used to amplify gene locus

Previous studies to investigate G. duodenalis used morphological methods or molecular technologies based on one or two gene loci (Table 1). Morphological examination is time- and labor-consuming, and cannot identify assemblages [26]. Molecular assay using one or two gene loci could not differentiate mixed infectious and did not provide sufficient information to understand the possible zoonotic links [27]. Recently, a multilocus genotyping technique was developed and has been applied to genotype G. duodenalis in dairy calves [28], native beef calves [20], sheep [15], raccoon dogs [29], children [30], pet chinchillas [31], red deer, roe deer [32] and other hosts [33]. Using four gene loci, namely β-giardin (bg), glutamate dehydrogenase (gdh), triosephosphate isomerase (tpi) and the small subunit ribosomal RNA (SSU rRNA), several multilocus genotypes (MLGs) and mixed genotypes were observed, including one MLGA and four MLGE in dairy calves [28], one MLGA, twenty-two MLGE and two mixed A + E in native beef calves [20], one MLGA, six MLGE and three mixed in sheep [15], three MLGC in raccoon dogs [29], two MLGA and three MLGE in pet chinchillas [31], and two MLGA and nine MLGE in children [30]. The objectives of the present study were to determine the prevalence and assemblages of G. duodenalis in pigs in Shaanxi Province, northwestern China, and investigate the MLGs in pigs using multilocus genotyping tool.

Methods

Sample collection

Shaanxi Province is located across the Qinling Mountains, which is the border between the North and South of China. It has gradually become one of the important regions of the pig industry due to environmental pollution and disease epidemics in the traditional pig breeding areas in northern China. In 2016, there were 3901 large pig farms operating in Shaanxi Province. In order to determine the prevalence and assemblage distribution of G. duodenalis in pigs in Shaanxi Province, northwestern China, 560 faecal samples were collected from pigs (newborn to 2 years) from five different farms in Zhouzhi, Qishan, Mianxian, Lintong and Yuyang, between September 2016 and March 2017 (Fig. 1). The 560 faecal samples comprised samples from suckling piglets aged < 25 days, weaned piglets aged 1–4 months, fatteners aged 4–6 months, and sows and boars aged 6 months to 2 years. Fresh normal faeces were randomly sampled from apparently healthy pigs of all age groups and for whom antibiotics or other antimicrobials were not used. Samples were placed into individual sterile plastic containers, marked with the geographical origin, date, breed, age and sample number. All faecal samples were then transported immediately to the laboratory on ice packs, preserved in 2.5% potassium dichromate and stored at 4 °C for further analysis.
Fig. 1

Sampling sites in this study

Genomic DNA extraction

Each faecal sample was washed three times in distilled water with centrifugation at 13,000 rpm for 1 min to remove the potassium dichromate. Genomic DNA of each sample was extracted from approximately 300 mg of washed faecal material, using the commercial E.Z.N.A® Stool DNA kit (Omega Bio-Tek Inc., Norcross, GA, USA), according to the manufacturer’s instructions. Extracted DNA samples were stored at -20 °C prior to PCR analysis.

Nested PCR amplification

The prevalence of G. duodenalis in pigs was initially determined by nested PCR targeting the bg gene fragment using primers described previously [34] in a 25 μl PCR mixture containing 1 μl genomic DNA (for the primary PCR) or 1 μl of the primary amplification product (for the secondary PCR) as the template, 2.5 μl 10× Ex Taq Buffer (Mg2+ free), 2 mM MgCl2, 0.2 mM dNTP Mixture, 0.625 U of TaKaRa Ex Taq (TaKaRa Shuzo Co., Ltd) and 0.4 μM of each primer (Table 2).
Table 2

PCR primers used in this study

Gene locus

Primer name

Sequence (5'-3')

Amplicon length (bp)

Annealing temperature (°C)

Reference

bg

G7-F

TCAACGTYAAYCGYGGYTTCCGT

573

52

[35]

G759-R

CAGTACACCTCYGCTCTCGG

 

G99-F

GAACGAACGAGATCGAGGTCCG

511

55

 

G609-R

CTCGACGAGCTTCGTGTT

 

tpi

AL3543

AAATIATGCCTGCTCGTCG

605

50

[34]

AL3546

CAAACCTTITCCGCAAACC

 

AL3544

CCCTTCATCGGIGGTAACTT

530

58

 

AL3545

GTGGCCACCACICCCGTGCC

 

gdh

GDHeF

TCAACGTYAAYCGYGGYTTCCGT

432

52

[35]

GDHeR

GTTRTCCTTGCACATCTCC

 

GDHiF

CAGTACACCTCYGCTCTCGG

432

65

 

GDHiR

GTTRTCCTTGCACATCTCC

 

To investigate multi-locus genotypes (MLGs) of G. duodenalis in pigs, the bg-positive samples were then amplified using primers for the gdh and tpi gene loci described previously [34, 35] (Table 2). The PCR products were then examined by electrophoresis in 1% (w/v) agarose gels with ethidium bromide staining.

Sequencing and sequence analysis

All positive PCR products were sent to Xi’an Qingke Biological Co., Ltd. for direct sequencing on an ABI PRISM 3730 XL DNA Analyzer (Applied Biosystems, Foster City, CA, USA) using relevant internal nested primers for PCR amplification. Sequences obtained were aligned with sequences available on GenBank using Basic Local Alignment Search Tool (BLAST), and edited using DNAStar 5.0 [36] and Clustal X 1.81 [37]. Giardia duodenalis assemblages were identified by their alignment to reference sequences available from GenBank. MLGs were identified for samples which were successfully sequenced at all three loci.

Statistical analysis

Chi-square (χ 2) analysis and 95% confidence intervals (CIs) were calculated using SPSS 19.0 for Windows (SPSS Inc., Chicago, IL, USA) and used to analyze differences between different locations and age groups, with P < 0.05 considered statistically significant.

Nucleotide sequence accession numbers

All nucleotide sequences obtained in this study were submitted to the National Center for Biotechnology Information (NCBI) GenBank database under the following accession numbers: KY989575–KY989579 for the bg gene, KY989580–KY989583 for the tpi gene, and MF034655–MF034658 for the gdh gene.

Results and discussion

Globally, Giardia duodenalis is one of the most common intestinal parasites in symptomatic and asymptomatic humans and livestock [38]; this species is relatively common in pigs worldwide (Table 1). Although no clinical signs are observed in most pigs carrying G. duodenalis, they still shed infective G. duodenalis cysts into the environment which can survive for extended periods in cool, humid environments. Considering that exposure to infective cysts through contaminated water and food is the primary mechanism of G. duodenalis transmission to animals and humans [39, 40], investigating G. duodenalis infection in pigs has important implications for controlling giardiasis in humans and animals.

Varying prevalence rates of G. duodenalis have been reported in livestock in China, e.g. 4.3–6.6% in sheep [1416], 2.9–12.7% in goats [16, 17] and 1.1–60.1% in cattle [1820]. In the present study, of the 560 faecal samples examined from five locations, 45 (8%, 95% CI: 7.4–8.7%) were positive for G. duodenalis infection (Table 3). Significantly different (χ 2 = 28.514, df = 4, P < 0.0001) prevalences were observed among different locations, with the highest (16.7%, 17/102) in Lintong district and the lowest (1.0%, 1/100) (χ 2 = 13.909, df = 1, P < 0.01) in Qishan county. Comparison of these results with results obtained from other pig farms showed that the prevalence of G. duodenalis in pigs in Shaanxi Province in China was lower than that in Australia (31.1%) [41], Ontario, Canada (66.4%) [42], Denmark (14.0–17.4%) [4345], Poland (9.5%) [46], Lusaka, Zambia (12.0%) [25], and Preston and Cheshire, UK (57.1%) [47], but higher than in Prince Edward Island, Canada (1.0%) [48], Preah Vihear, Cambodia (0) [49], Istanbul, Turkey (3.7%) [50], Norway (1.5%) [51] and Ohio, USA (7.4%) [52]. The differences are probably due to a range of factors, including the presence of other animal species on the farm, examination methods, study design, number of samples analysed, time of specimen collection, environmental conditions and farm management practices [28, 53]. For example, slightly higher prevalences were observed from some pig farms with multiple animal species raised in the same farms (e.g. 57.1% in the UK) (Table 1). In our study, two farms from Mianxian and Lintong also housed dogs and ducks, and the prevalence of G. duodenalis was comparatively higher (9.0% and 16.7%, respectively). These findings could suggest transmission between the different animals, which should be explored in future studies.
Table 3

Prevalence and factors associated with G. duodenalis infection in pigs in Shaanxi Province, northwestern China

Variable

Category

No. examined

No. positive (%)

Target locus (no. positive)

bg

tpi

gdh

Age

Suckling piglest

155

10 (6.5)

10

4

5

Weaned pigs

220

20 (9.1)

20

8

4

Fatteners

98

8 (8.2)

8

6

2

Sow

57

6 (10.5)

6

2

0

Boar

30

1 (3.3)

1

0

0

Total

560

45 (8.0)

45

20

11

Location**

Zhouzhi county

143

2 (1.4)

2

1

0

Qishan county

100

1 (1.0)

1

0

0

Mianxian county

100

9 (9.0)

9

5

3

Lintong district

102

17 (16.7)

17

12

4

Yuyang district

115

16 (13.9)

16

2

4

Total

560

45 (8.0)

45

20

11

**P < 0.0001

Differences in G. duodenalis prevalence were detected in pigs of different age groups in this study, but these differences were not statistically significant (χ 2 = 2.056, df = 4, P > 0.05). The highest prevalence (10.5%, χ 2 = 1.264, df = 1, P > 0.05) was detected in sow pigs, which was consistent with a study from Zambia (53.3%) [25], but was different to a study performed in Australia (30.0%) [41] and one study from Denmark (14.0%) [44], where the highest prevalence was found in weaned pigs. The second highest prevalence (9.1%) was observed in weaned pigs and the lowest infection rate was found in boars, with a prevalence of 3.3%, which was different with a study in Zambia [25], in which the sucking piglets had the lowest infection rate (25%). Although previous studies have suggested that the immunity, nutritional status, geographical separation and gut microbiome could contribute to the variable prevalence in pigs of different age groups [44], the actual association between pig age and G. duodenalis infection should be further evaluated in future studies.

Genetic variability of G. duodenalis has been reported in pigs and five assemblages (A, B, D, E, F) have been reported [41, 42, 4446]. In the present study, two assemblages, A and E, were detected among 45 G. duodenalis-positive samples based on the bg gene, with assemblage E (80%, 36/45) being the predominant assemblage, which was detected in all investigated areas and age groups. These results were consistent with a study in Australia [41] and two studies from Denmark [44, 45]. Additionally, the highest prevalence of the assemblage E was observed in weaned pigs in our study and studies in Denmark [44] and Australia [41]. While assemblage A (20%, 9/45) was only found in pigs from Zhouzhi county, Lintong district and Yuyang district, it was widely distributed in all age groups except boars. The reason from the higher prevalence of assemblage A in these specific locations is worthy of further investigation. Comparison with previous studies [41, 42, 44, 45] also indicated that this was the first report for assemblage A in sow.

To further illuminate the genetic diversity of G. duodenalis in pigs, the sequence characters of the tpi and gdh genes were analyzed for the 45 bg positive samples and the MLGs were characterized in pigs using combined data from these three gene loci. Of 45 bg-positive samples, 9 tpi and 11 gdh gene sequences were obtained. Sequence alignment identified different genotypes of assemblages E (Table 4) and A (Table 5). Eight faecal samples of assemblage E were successfully sequenced at all three gene loci, forming four different assemblage E MLGs, named as MLGE1-MLGE4 (Table 6). MLGE1 and MLGE4 were only found in weaned pigs from Mianxian county and fatteners from Yuyang district, respectively. Both MLGE2 and MLGE3 were detected in pigs from Lintong district, but they were distributed in different age groups, with MLGE2 in suckling pigs and MLGE3 in both weaned pigs and fatteners. Although no zoonotic assemblage A MLGs were obtained in our study, a mixed assemblage of E and A infections was found in one isolate (LTD6) from fatteners in Lintong district, which would be the result of mixed infection or genetic exchange between assemblages [20]. Previous studies also detected mixed infections of these two assemblages in pigs from Denmark based on gdh and SSU rRNA sequences [44] and other reports using bg, gdh, tpi, and SSU rRNA sequences in dairy calves [28], dairy cattle [20], and sheep [15]. This suggests that multilocus genotyping would be an accurate tool to determine mixed infections, zoonotic potential and genetic variability of G. duodenalis in animals as well as humans.
Table 4

Intra-assemblage substitutions in bg, tpi and gdh sequences from assemblage E

Subtype (number)

Nucleotide positions and substitutions

GenBank ID

 

57

120

180

 

bg

    

Ref. sequence

T

C

C

KU668892

E (36)

T

C

C

KY989575

 

56

143

340

 

tpi

    

Ref. sequence

C

C

C

KJ668136

E1 (6)

C

C

C

KY989581

E2 (8)

C

T

C

KY989580

E3 (1)

C

C

T

KY989582

 

68

216

285

303

 

gdh

     

Ref. sequence

T

T

C

C

JN160739

E1 (5)

T

C

C

T

MF034655

E2 (3)

T

T

T

C

MF034657

E3 (2)

T

T

T

C

MF034658

Table 5

Intra-assemblage substitutions in tpi, gdh and bg sequences from assemblage A

Subtype (number)

Nucleotide positions and substitutions

GenBank ID

 

58

122

255

269

307

 

bg

 Ref. sequence

C

C

A

A

C

KT728529

 A1 (4)

T

C

A

A

T

KY989576

 A2 (3)

C

C

A

A

C

KY989577

 A3 (1)

C

T

A

G

C

KY989578

 A4 (1)

C

C

G

A

C

KY989579

 

8

120

180

240

300

 

tpi

 Ref. sequence

C

A

G

A

A

KU382249

 A (5)

C

A

G

A

A

KY989583

 

56

120

180

240

300

 

gdh

 Ref. sequence

T

T

C

C

G

JF792402

 A (1)

T

T

C

C

G

MF034656

Table 6

Multilocus characterization of Giardia isolates based on the bg, tpi and gdh genes

Isolate

Genotype or subtype

MLG type

bg

tpi

gdh

ZZF6, LTB12, LTD2

E

E1

a

HZB5, HZB11, HZB19

E

E2

E1

MLGE1

HZB20, HZC9, LTA7

E

E2

a

LTA4, LTA18

E

E2

E2

MLGE2

LTB7, LTD10

E

E1

E1

MLGE3

LTB10

E

E3

a

LTD6

E

A

a

Mixed

LTD9, LTE14, LTE15

A1

A

a

YLA4

A2

a

A

YLA21

E

a

E2

YLA24

E

a

E3

YLA35

A2

A

a

YLD13

E

E1

E3

MLGE4

aNo amplification

Conclusions

The prevalence and MLGs of G. duodenalis in pigs from Shaanxi Province, northwestern China, were investigated in the present study. The total prevalence of G. duodenalis infection was 8% and the highest infection rate was observed in sow. Assemblage analysis indicated the presence of the animal-specific assemblage E and the potentially zoonotic assemblage A. Genetic diversity was found within both assemblages, and four assemblage E MLGs were discovered. To the best of our knowledge, this is the first investigation of G. duodenalis MLGs in pigs. The findings in our study provided basic data for understanding the molecular epidemiology of G. duodenalis in pigs, and highlighted the significance of multilocus genotyping for unraveling the intricate molecular epidemiology of giardiasis in animals and impact on livestock economics and human health. However, there were some limitations to the sampling strategies and study methodologies in our study. For example, no statistical analysis of prevalence in different seasons was conducted in our study. Therefore, additional factors should be included in future studies to accurately determine the infection status of G. duodenalis in pigs in Shaanxi Province as well as other geographical locations.

Abbreviations

Bg

β-giardin

Gdh

glutamate dehydrogenase

MLGs: 

multilocus genotyping

SSU rRNA: 

small subunit ribosomal RNA

Tpi

triosephosphate isomerase

Declarations

Acknowledgments

We would like to thank Zheng-Qing Yu and Hun-Jun Zhang for collecting samples, and Professor Una Ryan in School of Veterinary and Life Sciences, Murdoch University, Murdoch, WA, Australia, for copyediting our MS.

Funding

This work was supported, in part, by the Science and Technology Project of Shaanxi Province (2016NY-113). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article. Representative sequences are submitted to the GenBank database under the following accession numbers: KY989575–KY989579, KY989580–KY989583 and MF034655–MF034658.

Authors’ contributions

GHZ conceived and designed the experiments. SSW, JKS, YJY, RSH and YLY conducted the sample collection and the molecular genetic studies. SSW and GHZ performed the sequence analyzes. SSW and GHZ wrote and corrected the manuscript. All authors read and approved the final manuscript.

Ethics approval

The study was conducted and implemented in accordance with the Guide for the Care and Use of Laboratory Animals of the Ministry of Health, China and approved by the internal review board of the Research Ethics Committee of Northwest Agriculture and Forestry University, Yangling, China. All procedures performed in studies involving the collection of fecal samples were permitted by the farm owners.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
College of Veterinary Medicine, Northwest A&F University

References

  1. Nissapatorn V, Lim YA, Jamaiah I, Agnes LS, Amyliana K, Wen CC, et al. Parasitic infections in Malaysia: changing and challenges. Southeast Asian J Trop Med Public Health. 2005;36(Suppl 4):50–9.PubMedGoogle Scholar
  2. Feng Y, Xiao L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin Microbiol Rev. 2011;24:110–40.View ArticlePubMedPubMed CentralGoogle Scholar
  3. Koehler AV, Jex AR, Haydon SR, Stevens MA, Gasser RB. Giardia/giardiasis - a perspective on diagnostic and analytical tools. Biotechnol Adv. 2014;32:280–9.View ArticlePubMedGoogle Scholar
  4. Hibbard JH, Berkman N, McCormack LA, Jael E. The impact of a CAHPS report on employee knowledge, beliefs, and decisions. Med Care Res Rev. 2002;59:104–16.View ArticlePubMedGoogle Scholar
  5. Halliez MC, Buret AG. Extra-intestinal and long term consequences of Giardia duodenalis infections. World J Gastroenterol. 2013;19:8974–85.View ArticlePubMedPubMed CentralGoogle Scholar
  6. Tzanidakis N, Sotiraki S, Claerebout E, Ehsan A, Voutzourakis N, Kostopoulou D, et al. Occurrence and molecular characterization of Giardia duodenalis and Cryptosporidium spp. in sheep and goats reared under dairy husbandry systems in Greece. Parasite. 2014;21:45.Google Scholar
  7. Paz e Silva FM, Lopes RS, Bresciani KD, Amarante AF, Araujo JP Jr. High occurrence of Cryptosporidium ubiquitum and Giardia duodenalis genotype E in sheep from Brazil Acta Parasitol 2014;59:193–196.Google Scholar
  8. Ruiz A, Foronda P, González JF, Guedes A, Abreu-Acosta N, Molina JM, Valladares B. Occurrence and genotype characterization of Giardia duodenalis in goat kids from the Canary Islands, Spain. Vet Parasitol. 2008;154:137–41.View ArticlePubMedGoogle Scholar
  9. Matsuura Y, Matsubayashi M, Nukata S, Shibahara T, Ayukawa O, Kondo Y, et al. Report of fatal mixed infection with Cryptosporidium parvum and Giardia intestinalis in neonatal calves. Acta Parasitol. 2017;62:214–20.View ArticlePubMedGoogle Scholar
  10. Lee SH, VanBik D, Kim HY, Cho A, Kim JW, Byun JW, et al. Prevalence and molecular characterisation of Giardia duodenalis in calves with diarrhoea. Vet Rec. 2016;178:633.View ArticlePubMedGoogle Scholar
  11. Sricharern W, Inpankaew T, Keawmongkol S, Supanam J, Stich RW, Jittapalapong S. Molecular detection and prevalence of Giardia duodenalis and Cryptosporidium spp. among long-tailed macaques (Macaca fascicularis) in Thailand. Infect Genet Evol. 2016;40:310–4.View ArticlePubMedGoogle Scholar
  12. Berrilli F, Prisco C, Friedrich KG, Di Cerbo P, Di Cave D, De Liberato C. Giardia duodenalis assemblages and Entamoeba species infecting non-human primates in an Italian zoological garden: zoonotic potential and management traits. Parasit Vectors. 2011;4:199.View ArticlePubMedPubMed CentralGoogle Scholar
  13. Asher AJ, Hose G, Power ML. Giardiasis in NSW: identification of Giardia duodenalis assemblages contributing to human and cattle cases, and an epidemiological assessment of sporadic human giardiasis. Infect Genet Evol. 2016;44:157–61.View ArticlePubMedGoogle Scholar
  14. Ye J, Xiao L, Wang Y, Guo Y, Roellig DM, Feng Y. Dominance of Giardia duodenalis assemblage a and Enterocytozoon bieneusi genotype BEB6 in sheep in Inner Mongolia, China. Vet Parasitol. 2015;210:235–9.View ArticlePubMedGoogle Scholar
  15. Wang H, Qi M, Zhang K, Li J, Huang J, Ning C, Zhang L. Prevalence and genotyping of Giardia duodenalis isolated from sheep in Henan Province, central China. Infect Genet Evol. 2016;39:330–5.View ArticlePubMedGoogle Scholar
  16. Zhang W, Zhang X, Wang R, Liu A, Shen Y. Ling het al. Genetic characterizations of Giardia duodenalis in sheep and goats in Heilongjiang Province, China and possibility of zoonotic transmission. PLoS Negl Trop Dis. 2012;6:e1826.View ArticlePubMedPubMed CentralGoogle Scholar
  17. Peng XQ, Tian GR, Ren GJ, ZQ Y, Lok JB, Zhang LX, et al. Infection rate of Giardia duodenalis, Cryptosporidium spp. and Enterocytozoon bieneusi in cashmere, dairy and meat goats in China. Infect Genet Evol. 2016;41:26–31.View ArticlePubMedGoogle Scholar
  18. Wang X, Cai M, Jiang W, Wang Y, Jin Y, Li N, et al. High genetic diversity of Giardia duodenalis assemblage E in pre-weaned dairy calves in shanghai, China, revealed by multilocus genotyping. Parasitol Res. 2017;116:2101–10.View ArticlePubMedGoogle Scholar
  19. Li F, Wang H, Zhang Z, Li J, Wang C, Zhao J, et al. Prevalence and molecular characterization of Cryptosporidium spp. and Giardia duodenalis in dairy cattle in Beijing, China. Vet Parasitol. 2016;219:61–5.View ArticlePubMedGoogle Scholar
  20. Wang XT, Wang RJ, Ren GJ, ZQ Y, Zhang LX, Zhang SY, Lu H, Peng XQ, Zhao GH. Multilocus genotyping of Giardia duodenalis and Enterocytozoon bieneusi in dairy and native beef (Qinchuan) calves in Shaanxi Province, northwestern China. Parasitol Res. 2016;115:1355–61.Google Scholar
  21. Heyworth MF. Giardia duodenalis genetic assemblages and hosts. Parasite. 2016;23:13.View ArticlePubMedPubMed CentralGoogle Scholar
  22. Ryan U, Cacciò SM. Zoonotic potential of Giardia. Int J Parasitol. 2013;43:943–56.View ArticlePubMedGoogle Scholar
  23. Adamska M. Molecular characterization of Cryptosporidium and Giardia occurring in natural water bodies in Poland. Parasitol Res. 2015;114:687–92.View ArticlePubMedGoogle Scholar
  24. Hutchison ML, Walters LD, Avery SM, Synge BA, Moore A. Levels of zoonotic agents in British livestock manures. Lett Appl Microbiol. 2004;39:207–14.View ArticlePubMedGoogle Scholar
  25. Siwila J, Mwape KE. Prevalence of Cryptosporidium spp. and Giardia duodenalis in pigs in Lusaka, Zambia. Onderstepoort J Vet Res. 2012;79:E1–5.View ArticlePubMedGoogle Scholar
  26. Zechmann B, Graggaber G, Zellnig G. Microwave assisted rapid diagnosis of plant virus diseases by transmission electron microscopy. J Vis Exp. 2011;56:e2950.Google Scholar
  27. Lebbad M, Mattsson JG, Christensson B, Ljungström B, Backhans A, Andersson JO, Svärd SG. From mouse to moose: multilocus genotyping of Giardia isolates from various animal species. Vet Parasitol. 2010;168:231–9.View ArticlePubMedGoogle Scholar
  28. Qi M, Wang H, Jing B, Wang R, Jian F, Ning C, Zhang L. Prevalence and multilocus genotyping of Giardia duodenalis in dairy calves in Xinjiang, northwestern China. Parasit Vectors. 2016;9:546.View ArticlePubMedPubMed CentralGoogle Scholar
  29. Zhang XX, Zheng WB, Ma JG, Yao QX, Zou Y, Bubu CJ, et al. Occurrence and multilocus genotyping of Giardia intestinalis assemblage C and D in farmed raccoon dogs, Nyctereutes procyonoides, in China. Parasit Vectors. 2016;9:471.View ArticlePubMedPubMed CentralGoogle Scholar
  30. Wegayehu T, Karim MR, Li J, Adamu H, Erko B, Zhang L, Tilahun G. Multilocus genotyping of Giardia duodenalis isolates from children in Oromia special zone, central Ethiopia. BMC Microbiol. 2016;16:89.View ArticlePubMedPubMed CentralGoogle Scholar
  31. Qi M, Yu F, Li S, Wang H, Luo N, Huang J, Zhang L. Multilocus genotyping of potentially zoonotic Giardia duodenalis in pet chinchillas (Chinchilla lanigera) in China. Vet Parasitol. 2015;208:113–7.View ArticlePubMedGoogle Scholar
  32. Solarczyk P, Majewska AC, Moskwa B, Cabaj W, Dabert M, Nowosad P. Multilocus genotyping of Giardia duodenalis isolates from red deer (Cervus elaphus) and roe deer (Capreolus capreolus) from Poland. Folia Parasitol (Praha). 2012;59:237–40.View ArticleGoogle Scholar
  33. Solarczyk P, Majewska AC. Prevalence and multilocus genotyping of Giardia from animals at the zoo of Poznan, Poland. Wiad Parazytol. 2011;57:169–73.PubMedGoogle Scholar
  34. Sulaiman IM, Fayer R, Bern C, Gilman RH, Trout JM, Schantz PM, et al. Triosephosphate isomerase gene characterization and potential zoonotic transmission of Giardia duodenalis. Emerg Infect Dis. 2003;9:1444–52.View ArticlePubMedPubMed CentralGoogle Scholar
  35. Azcona-Gutiérrez JM, de Lucio A, Hernández-de-Mingo M, García-García C, Soria-Blanco LM, Morales L, et al. Molecular diversity and frequency of the diarrheagenic enteric protozoan Giardia duodenalis and Cryptosporidium spp. in a hospital setting in northern Spain. PLoS One. 2017;12:e0178575.View ArticlePubMedPubMed CentralGoogle Scholar
  36. Burland TG. DNASTAR's Lasergene sequence analysis software. Methods Mol Biol. 2000;132:71–91.PubMedGoogle Scholar
  37. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–82.View ArticlePubMedPubMed CentralGoogle Scholar
  38. Adam RD. Biology of Giardia lamblia. Clin Microbiol Rev. 2001;14:447–75.View ArticlePubMedPubMed CentralGoogle Scholar
  39. Olson ME, O'Handley RM, Ralston BJ, McAllister TA, Thompson RC. Update on Cryptosporidium and Giardia infections in cattle. Trends Parasitol. 2004;20:185–91.View ArticlePubMedGoogle Scholar
  40. Alexander C, Jones B, Inverarity D, Pollock KG. Genotyping of Giardia isolates in Scotland: a descriptive epidemiological study. Epidemiol Infect. 2014;142:1636–9.View ArticlePubMedGoogle Scholar
  41. Armson A, Yang R, Thompson J, Johnson J, Reid S, Ryan UM. Giardia genotypes in pigs in Western Australia: prevalence and association with diarrhea. Exp Parasitol. 2009;12:381–3.View ArticleGoogle Scholar
  42. Farzan A, Parrington L, Coklin T, Cook A, Pintar K, Pollari F, et al. Detection and characterization of Giardia duodenalis and Cryptosporidium spp. on swine farms in Ontario, Canada. Foodborne Pathog Dis. 2011:1207–13.Google Scholar
  43. Maddox-Hyttel C, Langkjaer RB, Enemark HL, Vigre H. Cryptosporidium and Giardia in different age groups of Danish cattle and pigs - occurrence and management associated risk factors. Vet Parasitol. 2006;141:48–59.View ArticlePubMedGoogle Scholar
  44. Petersen HH, Jianmin W, Katakam KK, Mejer H, Thamsborg SM, Dalsgaard A, et al. Cryptosporidium and Giardia in Danish organic pig farms: seasonal and age-related variation in prevalence, infection intensity and species/genotypes. Vet Parasitol. 2015;214:29–39.View ArticlePubMedGoogle Scholar
  45. Langkjaer RB, Vigre H, Enemark HL, Maddox-Hyttel C. Molecular and phylogenetic characterization of Cryptosporidium and Giardia from pigs and cattle in Denmark. Parasitology. 2007;134:339–50.View ArticlePubMedGoogle Scholar
  46. Stojecki K, Sroka J, Cencek T, Dutkiewicz J. Epidemiological survey in Łęczyńsko-Włodawskie Lake District of eastern Poland reveals new evidence of zoonotic potential of Giardia intestinalis. Ann Agric Environ Med. 2015;22:594–8.View ArticlePubMedGoogle Scholar
  47. Minetti C, Taweenan W, Hogg R, Featherstone C, Randle N, Latham SM, Wastling JM. Occurrence and diversity of Giardia duodenalis assemblages in livestock in the UK. Transbound Emerg Dis. 2014;61:e60–7.View ArticlePubMedGoogle Scholar
  48. Budu-Amoako E, Greenwood SJ, Dixon BR, Barkema HW, Hurnik D, Estey C, McClure JT. Occurrence of Giardia and Cryptosporidium in pigs on Prince Edward Island, Canada. Vet Parasitol. 2012;184:18–24.View ArticlePubMedGoogle Scholar
  49. Schär F, Inpankaew T, Traub RJ, Khieu V, Dalsgaard A, Chimnoi W, et al. The prevalence and diversity of intestinal parasitic infections in humans and domestic animals in a rural Cambodian village. Parasitol Int. 2014;63:597–603.View ArticlePubMedGoogle Scholar
  50. Uysal HK, Boral O, Metiner K, Ilgaz A. Investigation of intestinal parasites in pig feces that are also human pathogens. Turkiye Parazitol Derg. 2009;33:218–21.PubMedGoogle Scholar
  51. Hamnes IS, Gjerde BK, Forberg T, Robertson LJ. Occurrence of Cryptosporidium and Giardia in suckling piglets in Norway. Vet Parasitol. 2007;144:222–33.View ArticlePubMedGoogle Scholar
  52. Xiao L, Herd RP, Bowman GL. Prevalence of Cryptosporidium and Giardia infections on two Ohio pig farms with different management systems. Vet Parasitol. 1994;52:331–6.View ArticlePubMedGoogle Scholar
  53. Hashimoto A, Kunikane S, Hirata T. Prevalence of Cryptosporidium oocysts and Giardia cysts in the drinking water supply in Japan. Water Res. 2002;36:519–26.View ArticlePubMedGoogle Scholar
  54. Olson ME, Thorlakson CL, Deselliers L, Morck DW, McAllister TA. Giardia and Cryptosporidium in Canadian farm animals. Vet Parasitol. 1997;68:375–81.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s). 2017

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Advertisement