Skip to content

Advertisement

Parasites & Vectors

What do you think about BMC? Take part in

Open Access

Updated molecular phylogenetic data for Opisthorchis spp. (Trematoda: Opisthorchioidea) from ducks in Vietnam

Parasites & Vectors201710:575

https://doi.org/10.1186/s13071-017-2514-9

Received: 16 June 2017

Accepted: 31 October 2017

Published: 21 November 2017

Abstract

Background

An opisthorchiid liver fluke was recently reported from ducks (Anas platyrhynchos) in Binh Dinh Province of Central Vietnam, and referred to as “Opisthorchis viverrini-like”. This species uses common cyprinoid fishes as second intermediate hosts as does Opisthorchis viverrini, with which it is sympatric in this province. In this study, we refer to the liver fluke from ducks as “Opisthorchis sp. BD2013”, and provide new sequence data from the mitochondrial (mt) genome and the nuclear ribosomal transcription unit. A phylogenetic analysis was conducted to clarify the basal taxonomic position of this species from ducks within the genus Opisthorchis (Digenea: Opisthorchiidae).

Methods

Adults and eggs of liver flukes were collected from ducks, metacercariae from fishes (Puntius brevis, Rasbora aurotaenia, Esomus metallicus) and cercariae from snails (Bithynia funiculata) in different localities in Binh Dinh Province. From four developmental life stage samples (adults, eggs, metacercariae and cercariae), the complete cytochrome b (cob), nicotinamide dehydrogenase subunit 1 (nad1) and cytochrome c oxidase subunit 1 (cox1) genes, and near-complete 18S and partial 28S ribosomal DNA (rDNA) sequences were obtained by PCR-coupled sequencing. The alignments of nucleotide sequences of concatenated cob + nad1 + cox1, and of concatenated 18S + 28S were separately subjected to phylogenetic analyses. Homologous sequences from other trematode species were included in each alignment.

Results

Phylogenetic trees were inferred from concatenated (cob + nad1 + cox1) nucleotide sequences and combined 18S + 28S nucleotide sequences of five Opisthorchis sp. BD2013 samples and additional reference taxa. Both trees demonstrated the anticipated clustering of taxa within the superfamily Opisthorchioidea, the paraphyly of the genus Opisthorchis and the sister-species relationship of Opisthorchis sp. BD2013 with O. viverrini.

Conclusions

While it is likely that Opisthorchis sp. BD2013 is distinct from O. viverrini, it is clearly a sister taxon of O. viverrini within the limited number of Opisthorchis species for which appropriate sequence data are available. The new sequences provided here will assist the diagnosis and the taxonomic clarification of the opisthorchiid species.

Keywords

Mitochondrial geneRibosomal transcription unit Opisthorchis sp. BD2013Opisthorchiid18S rDNA28S rDNAPhylogenetic analysis

Background

The family Opisthorchiidae (Digenea: Opisthorchioidea) consists of 33 genera considered valid including the genera Opisthorchis and Clonorchis, in which O. viverrini, O. felineus and C. sinensis are known to infect humans [1]. Humans become infected by eating uncooked cyprinoid fish containing metacercariae. Opisthorchis viverrini has been reported in Central Vietnam, where Binh Dinh and Phu Yen Provinces are highly endemic for human opisthorchiasis [24].

In 2013, Dao et al. [5] found adults of an opisthorchiid species in ducks (Anas platyrhynchos) in areas of Binh Dinh Province where there are many human opisthorchiasis cases. This parasite was then given the working name “Opisthorchis viverrini-like”, because of its close similarity to O. viverrini [5, 6]. Subsequently, there has been a debate about the identity of this worm. Nawa et al. [7] argued that the duck liver fluke not be O. viverrini, but is most likely O. parageminus that was previously reported from ducks in Vietnam [810]. However, Dorny et al. [11] considered that their “Opisthorchis viverrini-like” species exhibited some morphological differences from O. parageminus. We now propose to use the working name “Opisthorchis sp. BD2013” instead of the earlier “Opisthorchis viverrini-like”.

Molecular phylogenetic/systematic studies are excellent aids for taxonomy [1215]. Such studies require homologous sequences from as many taxa as possible within the group of interest. In the genus Opisthorchis, a number of genetic markers from complete mitochondrial sequences and the nuclear ribosomal transcription units including, ITS1, ITS2, 18S rDNA and partial 28S rDNA have been generated for O. viverrini, O. felineus and Clonorchis sinensis. These genetic markers have greatly contributed to molecular diagnostic, epidemiological, phylogenetic and evolutionary studies of the species in Opisthorchiidae and trematodes [3, 13, 1619]. However, Opisthorchis is a very large genus [7], and molecular data are available for only a few species. Moreover, given difficulties with the morphological taxonomy within the genus, it is not always certain that names assigned to samples are accurate. The only molecular data claimed to be from O. parageminus consist of two sequences recently deposited in GenBank (accession numbers KX258656, KX258657) by Nguyen and Nguyen (otherwise unpublished data). Although their worms came from ducks in Vietnam, no information is available on the morphological basis for the identification. Both of these sequences (mitochondrial partial mt cox1 and nuclear ribosomal ITS2) are very similar to earlier sequences available for Opisthorchis sp. BD2013 published by [5]. Here, we provide additional mitochondrial sequences, i.e. complete cytochrome b (cob), nicotinamide dehydrogenase subunit 1 (nad1) and cytochrome c oxidase subunit 1 (cox1) genes, and near-complete 18S rDNA and partial 28S rDNA sequences in an effort to better resolve the affinities of Opisthorchis sp. BD2013 within the family Opisthorchiidae and the superfamily Opisthorchioidea.

Methods

Opisthorchis sp. BD2013 samples collected from the field

Adult specimens and eggs of Opisthorchis sp. BD2013 were collected from naturally infected domestic ducks (Anas platyrhynchos) originating from 4 localities (Phu Cat, Phu My, An Nhon and Tuy Phuoc Districts) in Binh Dinh Province of Central Vietnam [6, 20] (Table 1). Each adult worm, unstained or stained with acetic carmine, was morphologically identified by light microscopy [5]. Up to three adult worms from each locality were individually fixed in 70% ethanol, and one or two worms from each locality were separately subjected to genomic DNA extraction and molecular analysis.
Table 1

List of field samples used in this study, their geographical collection site in Binh Dinh province and their hosts

Life-cycle stage

Site collected (district)

Host

Scientific name

Sample abbreviation for use in this study

Adult worm

Phu Cat

Duck

Anas platyrhynchos

Opisthorchis sp. BD2013-PC6aduBD

Adult worm

Phu My

Duck

Anas platyrhynchos

Opisthorchis sp. BD2013-PM10aduBD

Adult worm

An Nhon

Duck

Anas platyrhynchos

 

Adult worm

Tuy Phuoc

Duck

Anas platyrhynchos

 

Metacercariae

Phu My

Fish

Puntius brevis

Opisthorchis sp. BD2013-PCmetaBD

Metacercariae

Phu My

Fish

Rasbora aurotaenia

 

Metacercariae

Phu My

Fish

Esomus metallicus

 

Cercariae

Phu My

Snail

Bithynia funiculata

Opisthorchis sp. BD2013-PCcercaBD

Eggs

Phu My

Duck

Anas platyrhynchos

Opisthorchis sp. BD2013-PCeggBD

Fishes (harbouring metacercariae) and snails (shedding cercariae) were collected from My Tho Lake in the lowlands of Binh Dinh Province [20]. Infected fishes were identified as Puntius brevis, Esomus metallicus, Rasbora aurotaenia, and the snail as Bithynia funiculata [20] (Table 1). For molecular analysis, metacercariae and cercariae were individually fixed in RNAlater™ buffer (Qiagen, Texas, USA) at 4 °C. Individual parasites from each intermediate host and each locality were used for extraction of DNA and molecular study.

Eggs were individually collected from the gallbladder of naturally infected ducks by washing and centrifuging the bile ten times in normal saline (0.9% NaCl), then three times in phosphate buffered saline (PBS) before storage at -20 °C until use (Table 1).

Genomic DNA extraction and primers

Total genomic DNA was extracted from individual adults, metacercariae, cercariae or pooled eggs (approximately 2000–3000 eggs) using the GeneJET™ Genomic DNA Purification Kit (Thermo Fisher Scientific Inc., MA, USA), according to the manufacturer’s instructions. A slight modification applied for eggs was to increase the incubation period by 3–4 h after enzymatic lysis. Genomic DNA was eluted in 50 μl of the elution buffer provided in the kit and stored at -20 °C. The DNA concentration was estimated using a GBC UV/visible 911A spectrophotometer (GBC Scientific Equipment Pty. Ltd., Braeside, Australia) and diluted to a working concentration of 50 ng/μl (about 10 ng/μl for DNA from eggs). From this genomic DNA, 2–3 μl was used as template in a PCR of 50 μl volume.

Primers used both for amplification and sequencing of the mitochondrial and nuclear ribosomal genes are listed in Table 2. The primer pair OACOBF/OACO1R amplified approximately 7.8 kb of mtDNA. Based on the sequence obtained from this amplicon, three primer pairs specific for the individual target protein-coding genes were designed. Primer pairs OACOBF/OACOBR, OAND1F/OAND1R, OACO1F/OACO1R amplified complete cob, nad1 and cox1 genes, respectively. The primer pairs U18SF/U18SR were used for obtaining major fragments of ribosomal 18S and U28SF/U28SR for 28S, respectively [12]. Additional internal primers were designed and used as needed (Table 2).
Table 2

Primers for amplification and sequencing of the mitochondrial protein-coding and nuclear ribosomal genes used in this study

Primer name

Sequence (5′–3′)

Target gene

Amplicon by PCR

Length of sequence (bp)

Reference

OACOBF

AGCCGGAGAGTCATTGTGTG

cob

1.4 kb

1110

This study

OACOBR

TGAATCCCACAACCGCGTTA

    

OACOBR2a

TACGTTGAAGGACGGGTTGG

    

OAND1F

CGTGTGGTGGGGCAAGATAG

nad1

1.2 kb

903

This study

OAND1R

CCACACAGCCTTCTCAAGGT

    

OACO1F

GAGGGTTACGTGGGTTGGAG

cox1

1.8 kb

1551

This study

OACO1R

CAACCCTACTAAGCACCACAGC

    

OACO1R2a

GGATCCCAAAAACGCTCACG

    

U18SF

GCGAATGGCTCATTAAATCAGC

18S

1.8 kb

~ 1790

[12]

U18SR

GGAACCAATCCGAGGACCTTGC

    

NS2Fa

GCAAGTCTGGTGCCAGCAGCC

    

U28SF

CTAACAAGGATTCCCTTAGTAAC

28S

1.3 kb

~ 1100

[12]

U28SR

GTCTTTCGCCCCTATACTCAC

    

Abbreviations: F forward, R reverse

aInternal primer used for sequencing

Amplification of mitochondrial and ribosomal genes

The 7.8 kb mt genomic region

Long PCR reactions were prepared using 25 μl of Fusion High-Fidelity PCR Master Mix (2×) (Thermo Fisher Scientific Inc., Waltham, MA, USA) and 2 μl of each primer (10 pmol/μl), 2 μl DNA template of the adult sample (50 ng/μl), 2 μl DMSO (dimethyl sulfoxide) and 17 μl H2O up to a final volume of 50 μl. All PCRs were performed in an MJ PTC-100 thermal cycler with initiation at 98 °C for 30 s, followed by 35 cycles consisting of denaturation for 10 s at 98 °C, annealing at 56 °C for 30 s, extension at 72 °C for 6 min.

Individual mt and ribosomal DNA genes

PCR reactions of 50 μl were prepared using 25 μl of DreamTaq PCR Master Mix (2×) (Thermo Fisher Scientific Inc., Waltham, MA, USA), 2 μl of each primer (10 pmol/μl), 2 μl DNA template (50 ng/μl for adults; 50 ng/μl for metacercariae; 10–20 ng/μl for cercariae and eggs), 2 μl DMSO (dimethyl sulfoxide) and 17 μl H2O. All PCRs were performed in an MJ PTC-100 thermal cycler with initiation at 94 °C for 5 min, followed by 35 cycles consisting of denaturation for 30 s at 94 °C, annealing at 56 °C for 30 s, extension at 72 °C for 3 min.

Sequencing and sequence analyses

PCR products were obtained from at least two individual samples for each template (i.e. adults, metacercariae, cercariae and eggs) originating from different geographical localities. The PCR products (10 μl of each) were examined on a 1% agarose gel, stained with ethidium bromide, and visualized under UV light (Wealtec, Meadowvale Way Sparks, USA).

All the purified or gel-extracted amplicons were subjected to direct sequencing by automated sequencers using amplifying/flanking and internal primers (Table 2) by primer-walking in both directions (Macrogen Inc., Seoul, South Korea). Sequences (two from each sample) were aligned to obtain the final sequence for characterization. All sequences of Opisthorchis sp. BD2013 were identical, regardless of the life-cycle stage or locality.

The concatenated nucleotide and amino acid sequences of three protein-coding genes, i.e., cob + nad1 + cox1, were used to infer the pairwise genetic distances between 10 opisthorchiids (Table 3). These isolates included Opisthorchis sp. BD2013 and the reference sequences from Laos (JF739555), Vietnam (MF287777–MF287779) and Thailand (MF287780–MF287782). The genetic distances were inferred by pairwise analysis using the MEGA6.0 software, and the number of base substitutions per site was calculated by the most simplified method (uncorrected p-distance) [21].
Table 3

Summary data for complete mitochondrial genomes of species providing cytochrome b (cob), nicotinamide dehydrogenase subunit 1 (nad1) and cytochrome c oxidase subunit 1 (cox1) used in the phylogenetic analysis including Opisthorchis sp. BD2013 in ducks in Vietnam

Family/Species

Isolates/Strains

Country

GenBank ID

Reference

Opisthorchiidae

Opisthorchis sp. BD2013

PC6aduBD

Vietnam

MF287762–MF287764

This study

Opisthorchis sp. BD2013

PM10aduBD

Vietnamb

MF287765–MF287767

This study

Opisthorchis sp. BD2013

PCmetaBD

Vietnam

MF287768–MF287770

This study

Opisthorchis sp. BD2013

PCcercaBD

Vietnam

MF287771–MF287773

This study

Opisthorchis sp. BD2013

PCeggBD

Vietnam

MF287774–MF287776

This study

Opisthorchis viverrini

na

Laosb

JF739555

[19]

Binh Dinh 1

Vietnamb

MF287777–MF287779

This study

Khon Kaen

Thailandb

MF287780–MF287782

This study

Opisthorchis felineus

Ust-Tula (Novosibirsk)

Russiab

EU921260

[16]

Clonorchis sinensis

Nam Dinh

Vietnamc

MF287783–MF287785

This study

Guangdong

Chinab

JF729303

[19]

na

South Koreab

JF729304

[19]

Amur - Khabarovsk

Russiab

FJ381664

[16]

Metorchis orientalis

Heilongjiang

Chinab

KT239342

[22]

Heterophyidae

    

Haplorchis taichui

na

Laos

KF214770

[24]

Quang Tri 3

Vietnam

MF287786–MF287788

This study

Metagonimus yokogawai

na

South Korea

KC330755

 

Fasciolidae

    

Fasciola hepatica

Geelong

Australia

AF216697

[25]

Fasciola gigantica

Guangxi

China

KF543342

[26]

Thua Thien-Hue

Vietnam

MF287789–MF287791

This study

Fasciola sp. (intermediate form)

GHL-Heilongjiang

China

KF543343

[26]

Fasciolopsis buski

Jiangxi

China

KX169163

[27]

Ha Tay

Vietnam

MF287792–MF287794

This study

Fascioloides magna

Kokořínsko

Czech Republic

KU060148

[28]

Schistosomatidae

    

Schistosoma haematobium a

N10 Village

Mali

DQ157222

[29]

aSequence used as the outgroup

bSequences of the opisthorchiids used for pairwise genetic distance calculation (Tables 5 and 6)

Phylogenetic analysis

Preparation of DNA sequences

Phylogenetic analysis using three mitochondrial protein-coding (cob, nad1, cox1) and two nuclear ribosomal (18S and 28S rDNA) genes was conducted to examine the taxonomic placement of Opisthorchis sp. BD2013 from ducks within the superfamily Opisthorchioidea. Sequences of trematode species/isolates of the Opisthorchiidae, Heterophyidae, Fasciolidae and Schistosomatidae (as the outgroup) were used. Summary data of species/isolates, mainly from the available complete mitochondrial genomes are presented in Table 3. Accession numbers for the target and reference 18S and 28S rDNA sequences are listed in Table 4. For Opisthorchis sp. BD2013, we decided to use only two sequences of adults, and one each from metacercariae, cercariae and eggs for phylogenetic analyses.
Table 4

Accession numbers of the reference 18S and 28S rDNA sequences and their species information used for phylogenetic analysis with those derived from Opisthorchis sp. BD2013 in ducks in the present study

Family/Species

18S rDNA GenBank ID (isolate)b

28S rDNA GenBank ID (isolate)b

Origin of sequences

Reference

Opisthorchiidae

Opisthorchis sp.

MF077358 (PC6aduBD)b

MF110001 (PC6aduBD)

Vietnam

This study

MF077359 (PCcercaBD)

MF110002 (PCcercaBD)

Vietnam

This study

MF077360 (PCeggBD)

MF110003 (PCeggBD)

Vietnam

This study

MF077361 (PCmetaBD)

MF110004 (PCmetaBD)

Vietnam

This study

MF077362 (PM10aduBD)

MF110005 (PM10aduBD)

Vietnam

This study

Opisthorchis viverrini

HM004211 (SK)

HM004188 (SK);

Thailand

[30]

JF823987 (THASK)

JF823990 (THASK)

Thailand

[17]

MF077364 (PY2)

MF099792 (PY2)

Vietnam

GenBank

MF077363 (BD1)

KY369165 (BD1)

Vietnam

GenBank

Opisthorchis felineus

MF077357 (Ust-Tula)

MF099790 (Ust-Tula)

Russia

GenBank

Clonorchis sinensis

JF823988 (VNM)

JF823989 (VNM)

Vietnam

[30]

JF314770 (GD)

JF823989 (VNM)

China; Vietnam

GenBank; [30]

MF077353 (NH)

MF099784 (NH)

Vietnam

GenBank

Heterophyidae

Haplorchis pumilio

HM004194 (HpNP1)

HM004186 (HpNP1)

Thailand

[18]

KX815125 (HPU8)

KX815125 (HPU8)

Vietnam

[12]

Haplorchis taichui

KX815126 (QT3)

KX815126 (QT3)

Vietnam

[12]

HM004201 (NA3)

HM004187 (NA3)

Thailand

[30]

Haplorchis yokogawai

HM004207 (CP1)

HM004178 (CP1)

Thailand

[18]

HM004208 (CP2)

KY369160 (An394)

Thailand; Vietnam

[12, 18]

Procerovum varium

HM004199 (PvNP1)

HM004182 (PvNP1)

Thailand

[30]

MF077365 (HspND)

KY369161 (HspND)

Vietnam

GenBank; [12]

Stellantchasmus falcatus

HM004202 (VN1)

HM004174 (VN1)

Vietnam

[17]

MF077366 (QN2)

KY369164 (QN2)

Vietnam

[12]

Metagonimus takahashii

HQ832629 (Mt3)

HQ832638 (Mt3)

Japan

[31]

Metagonimus yokogawai

HQ832630 (My1)

HQ832639 (My1)

Japan

[31]

Metagonimus miyatai

HQ832626 (Mm3)

HQ832635 (Mm3)

Japan

[31]

Fasciolidae

Fasciolopsis buski

AY311386 (Vinh)

EU025870 (NA)

Vietnam

[32]

Fasciola gigantica

MF077354 (NB)

MF099787 (NB)

Vietnam

GenBank

Fasciola hepatica

MF077355 (Geelong)

MF099788 (Geelong)

Australia

GenBank

Fascioloides magna

EF051080

EU025872

United States

GenBank; [33]

Schistosomatidae

Schistosoma haematobium a

Z11976

AY157263

Mali

[34, 35]

aSequence used as the outgroup

bAbbreviations for isolates are given in parentheses

Concatenated nucleotide sequences of mt protein-coding genes (cob, nad1, cox1) from adults, metacercariae, cercariae, and eggs of Opisthorchis sp. BD2013, and from additional taxa (available in GenBank; see Table 3) were imported into GENEDOC 2.7 (available at http://iubio.bio.indiana.edu/soft/molbio/ibmpc/genedoc-readme.html) and aligned for phylogenetic analysis. Additionally, the sequences of opisthorchiids were translated (using the echinoderm/flatworm mitochondrial genetic code: translation Table 9 in GenBank), and the deduced amino acid sequences were aligned for pairwise genetic distance analysis.

DNA sequences of 18S rRNA and 28S rRNA genes (listed in Table 4) were aligned separately using GENEDOC 2.7. The sequences were trimmed at both ends to the shortest length of the representative sequences. For 18S rDNA, in this study, the final alignment was 2005 nucleotides (nt) long of which 87 nt positions were trimmed at 5′ end and 114 nt at 3′ end, leaving 1804 characters for analyses. For 28S rDNA, the final alignment was1449 nt long of which 122 nt positions were trimmed at 5′ end and 123 nt at 3′ end, leaving 1202 characters for analyses. The two sequences were then concatenated as indicated in Table 4, preferably from the same strains/isolates. The concatenated 18S + 28S rDNA sequences representing species/isolates were imported into GENEDOC 2.7 and phylogenetic analysis and tree construction were done by MEGA6.0 [21].

Phylogenetic reconstruction

The alignments of the concatenated nucleotide (cob, cox1, nad1) and 18S +28S sequences, respectively, were trimmed to the length of the shortest sequence and imported into the MEGA 6.06 software [21]. Maximum likelihood (ML) analyses were performed in each case. For DNA sequences, we used the general time-reversible model of evolution with gamma distributed rate heterogeneity and a proportion of invariant sites (GTR + Γ + I). This model was given the best Bayesian information criterion score by MEGA. For amino acid sequences, the Jones-Taylor-Thornton (JTT) model with uniform rates and Nearest-Neighbor-Interchange (NNI) method was used. The confidence in each node was assessed using 1000 bootstrap resamplings [21].

Results

Mitochondrial cob, nad1, cox1 and genetic distances among opisthorchiid species/sequences

For Opisthorchis sp. BD2013, lengths of the complete cob, nad1 and cox1 genes were 1110, 903 and 1551 nucleotides, respectively. Among opisthorchiid species, cob genes ranged in length from 1110 to 1116 nt, and cox1 genes were 1551 to 1563 nt in length. The primer pairs U18SF/U18SR were used for obtaining major fragments of ribosomal 18S and U28SF/U28SR for 28S rDNA.

Nucleotide and amino acid pairwise comparisons of the concatenated mt genes among ten opisthorchiid isolates/species are presented in Tables 5 and 6. The concatenated cob + nad1 + cox1 nucleotide sequences of Opisthorchis sp. BD2013 differed at 14.4–14.5% of nucleotide sites and 10.3–10.6% of amino acid positions from the reference sequences of O. viverrini (Vietnam, Thailand and Laos isolates) [19]; 17.9–18.2% for nucleotides and 13.3–13.7% for amino acids from C. sinensis (Russia, China, South Korea and Vietnam isolates); 18.1% (nucleotides) and 13.7% (amino acids) from O. felineus (a Russian isolate) [16] and 15.4% (nucleotides) and 11.6% (amino acids) from Metorchis orientalis (China isolate) [23].
Table 5

Pairwise genetic distances (%) between Opisthorchis sp. BD2013 sample from ducks in Vietnam and the sequences for O. viverrini, Clonorchis sinensis, O. felineus and Metorchis orientalis of the concatenated mitochondrial genes cob, nad1 and cox1

 

Species

GenBank ID

1

2

3

4

5

6

7

8

9

10

1

Opisthorchis sp. BD2013 (PM10aduBD/Vietnam)

MF287767

         

2

O. viverrini (Binh Dinh 1/ Vietnam)

MF287779

14.4

        

3

O. viverrini (Khon Kaen/ Thailand)

MF287782

14.5

0.4

       

4

O. viverrini (Laos)

JF739555

14.4

0.5

0.7

      

5

C. sinensis (Amur-Khabarovsk/Russia)

FJ381664

17.9

18.1

18.1

17.9

     

6

C. sinensis (Guangdong/ China)

JF729303

18.0

18.1

18.1

17.9

0.4

    

7

C. sinensis (South Korea)

JF729304

18.2

18.2

18.3

18.0

0.5

0.3

   

8

C. sinensis (Nam Dinh/ Vietnam)

MF287784

18.0

18.1

18.2

18.0

0.5

0.5

0.6

  

9

O. felineus (Ust-Tula/ Russia)

EU921260

18.1

18.8

18.9

18.7

15.4

15.6

15.8

15.5

 

10

Metorchis orientalis (Heilongjiang/China)

KT239342

15.5

13.7

13.7

13.5

17.0

17.2

17.2

17.0

16.8

Table 6

Pairwise genetic distances (%) between Opisthorchis sp. BD2013 sample from ducks in Vietnam and O. viverrini, Clonorchis sinensis, O. felineus and Metorchis orientalis of the concatenated mitochondrial amino acid sequence of cob, nad1 and cox1

 

Nucleotide sequences

Accession No.

1

2

3

4

5

6

7

8

9

10

1

Opisthorchis sp. BD2013 (PM10aduBD/Vietnam)

MF287767

         

2

O. viverrini (Binh Dinh 1/ Vietnam)

MF287779

10.6

        

3

O. viverrini (Khon Kaen/ Thailand)

MF287782

10.6

0.5

       

4

O. viverrini (Laos)

JF739555

10.3

0.6

0.6

      

5

Clonorchis sinensis (Amur-Khabarovsk/Russia)

FJ381664

13.3

12.4

12.4

12.4

     

6

C. sinensis (Guangdong/ China)

JF729303

13.5

12.8

12.8

12.8

0.3

    

7

C. sinensis (South Korea)

JF729304

13.7

12.7

12.7

12.7

0.3

0.2

   

8

C. sinensis (Nam Dinh/ Vietnam)

MF287784

13.6

12.6

12.6

12.6

0.4

0.8

0.8

  

9

O. felineus (Ust-Tula/ Russia)

EU921260

13.7

13.8

13.9

13.9

9.3

9.7

9.7

9.5

 

10

Metorchis orientalis (Heilongjiang/China)

KT239342

11.6

8.8

8.8

8.7

9.8

10.2

10.2

10.1

11.0

Within each opisthorchiid taxon, pairwise genetic distances were small, only 0.4–0.7% for nucleotides and 0.5–0.6% for amino acids within O. viverrini; 0.3–0.6% (nucleotides) and 0.2–0.8% (amino acids) within C. sinensis. Opisthorchis sp. BD2013 in ducks differs from O. viverrini by more than 10%, a figure comparable to those separating species within the genus Opisthorchis and the family Opisthorchiidae (Tables 5 and 6).

Phylogenetic analysis

Phylogenetic reconstruction based on the complete cob + nad1 + cox1 amino acid sequences

A phylogenetic tree was constructed from 25 nucleotide sequences inferred from complete cob + nad1 + cox1 of 13 trematode species belonging to 4 families with Schistosoma haematobium of the Schistosomatidae as the outgroup (Table 3, Fig. 1). The superfamily Opisthorchioidea in this study comprises the Heterophyidae and Opisthorchiidae (no appropriate sequences from the third family, Cryptogonimidae, were available), with the strong nodal support of 99%, clearly separate from the family Fasciolidae. The Opisthorchis sp. BD2013 clade was placed as a sister of O. viverrini from Thailand, Vietnam and Laos. The genus Opisthorchis appeared as paraphyletic with respect to C. sinensis, O. felineus and M. orientalis (Fig. 1).
Fig. 1

Phylogenetic tree for Opisthorchis sp. BD2013 (indicated by diamond symbol) and other opisthorchiids and representative trematodes from 4 families, the Opisthorchiidae, Heterophyidae, Fasciolidae and Schistosomatidae (the latter used as an outgroup), based on concatenated nucleotide sequences of complete cytochrome b (cob), nicotinamide dehydrogenase subunit 1 (nad1) and cytochrome c oxidase subunit 1 (cox1) genes. Phylogenetic reconstruction was performed using maximum likelihood analysis with the general time-reversible model with a gamma distributed rate heterogeneity and a proportion of invariant sites (GTR + Γ+ I) in the MEGA6.06 software package. Support for each node was evaluated using 1000 bootstrap resamplings [21]. The scale-bar indicates the number of substitutions per site. Accession numbers (where available) are given at the end of each sequence name. Isolates/geographical localities are given in parentheses (if available). Country abbreviation codes (2-letter) given prior to the accession numbers: AU, Australia; CN, China; CZ, Czech Republic; KR, Korea; LA, Lao PDR; RU, Russia; TH, Thailand; VN, Vietnam

Phylogenetic reconstruction based on partial 18S + 28S sequences

Five concatenated 18S + 28S sequences of Vietnamese Opisthorchis sp. BD2013 (from eggs, cercariae, metacercariae and adults) were aligned with 26 available sequences representing 17 trematode species of the Opisthorchiidae, Heterophyidae, Fasciolidae and Schistosomatidae (outgroup) (Table 4). The nuclear ribosomal dataset from the Opisthorchioidea included available sequences of the 18S + 28S of 12 taxa only from the Opisthorchiidae and Heterophyidae (data from the Cryptogonimidae were not available). The combined length of alignment in use was between 2940 and 2960 nt. The inferred phylogenetic tree (Fig. 2) again placed Opisthorchis sp. BD2013 in a sister position with O. viverrini from Thailand and Vietnam. Again, the genus Opisthorchis appeared as paraphyletic. Monophyly of the superfamily Opisthorchioidea was strongly supported (Fig. 2).
Fig. 2

Phylogenetic tree for Opisthorchis sp. BD2013 (indicated by diamond symbol) and other opisthorchiids and representative trematodes from 4 families, the Opisthorchiidae, Heterophyidae, Fasciolidae and Schistosomatidae (the latter used as the outgroup), based on combined nucleotide sequences of the nuclear small ribosomal subunit (18S rDNA) and large ribosomal subunit (28S rDNA). Phylogenetic reconstruction was performed using maximum likelihood analysis with the general time-reversible model and a gamma distributed rate heterogeneity and proportion of invariant sites (GTR + Γ+ I) in the MEGA6.06 software package. Support for each node was evaluated using 1000 bootstrap resamplings [21]. The node for the superfamily (infraorder) Opisthorchioidea is indicated by an arrow. The scale-bar indicates the number of substitutions per site. Accession numbers are given at the end of each sequence name. Isolates or geographical localities and country isolated are given in the between (if available)

Discussion

In this study, we used two concatenated datasets to infer the molecular phylogenetic position of Opisthorchis sp. BD2013 (formerly named “Opisthorchis viverrini-like” or as O. parageminus by several authors). We did not have samples of O. lobatus [17] and the so-called O. parageminus [8, 9] for analysis in the present study, therefore, we were not able to establish the relationship between Opisthorchis sp. BD2013 and these species.

The genus Opisthorchis is very large [7], but relevant sequence data are limited to only a few species. It was necessary to determine whether Opisthorchis sp. BD2013 from ducks is distinct from O. viverrini, a zoonotic liver fluke known to infect and to cause cholangiocarcinoma in humans [23]. The data presented in this study strongly imply that the two are distinct species. The sister-species relationship demonstrated between Opisthorchis sp. BD2013, and O. viverrini might simply be because O. felineus is the only other member of the genus for which data are available. Opisthorchis felineus renders Opisthorchis paraphyletic in our trees, indicating that much systematic work remains to be done in the Opisthorchiidae. A further unresolved question is the relationship between Opisthorchis sp. BD2013 and O. parageminus. Both were found in ducks in Vietnam, but some morphological differences seem to exist [11]. At this stage, we prefer to leave the question open, pending future morphological and molecular work.

Our previous phylogenetic analysis using short sequences of ITS2 and cox1 revealed close affinities between O. viverrini, O. lobatus and Opisthorchis sp. BD2013 [5]. In the current study, we are unable to resolve the status of O. lobatus compared to Opisthorchis sp. BD2013 and other opisthorchiids.

Conclusions

Based on mitochondrial cob + nad1 + cox1 and ribosomal 18S + 28S rRNA sequence analyses, Opisthorchis sp. BD2013 was distinct from O. viverrini, although the two species are closely related. The genus Opisthorchis itself appears as paraphyletic. Data from additional Opisthorchis species are vital to create a phylogeny with higher resolution within Opisthorchis and the Opisthorchiidae.

Abbreviations

cob

cytochrome b

cox1: 

cytochrome c oxidase subunit 1

MEGA: 

Molecular Evolutionary Genetics Analysis

ML: 

maximum likelihood

mt: 

mitochondrial

nad1: 

nicotinamide dehydrogenase subunit 1

rTU: 

ribosomal transcription unit

Declarations

Acknowledgments

We express our thanks to colleagues and technicians at the Binh Dinh Provincial station of veterinary services for providing and processing samples and Ms TK Nguyen and Dr. HTT Doan of the Institute of Biotechnology, Hanoi, Vietnam for contributing to our laboratory work. We would like to express our gratitude to Professor David Blair, College of Science and Engineering, James Cook University, Townsville, Australia for revision and invaluable comments on this paper.

Funding

This work was funded by the Directorate General for Development Cooperation (DGD) Belgium, through the individual PhD Programme (THT Dao) of the Institute of Tropical Medicine Belgium under the DGD-ITM Framework agreements 3 and 4.

Availability of data and materials

The data sets supporting the alignment and phylogenetic analysis are included in the article. Nucleotide sequences obtained in the present study have been deposited into the GenBank database with the following accession numbers: MF077358–MF077362 (18S rDNA; Opisthorchis sp. BD2013); MF110001–MF110005 (28S rDNA; Opisthorchis sp. BD2013); MF287762–MF287776 (cob, nad1, cox1; Opisthorchis sp. BD2013).

Authors’ contributions

THTD, PD and THL conceived the study, analyses of final data and wrote the manuscript. TGTN, KLB and SG conducted field collections, laboratory, and preliminary sequence analyses. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Appropriate permission was obtained from the commune authorities and local households before the collection of parasite specimens from their stocks.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
National Institute of Veterinary Research
(2)
Department of Biomedical Sciences, Institute of Tropical Medicine
(3)
Department of Virology, Parasitology and Immunology, Faculty of Veterinary Medicine, Ghent University
(4)
Department of Veterinary Public Health and Food Safety, Faculty of Veterinary Medicine, Ghent University
(5)
Department of Parasitology, Faculty of Veterinary Medicine, Vietnam National University of Agriculture
(6)
Department of Immunology, Institute of Biotechnology and Graduate University of Science and Technology, Vietnam Academy of Science and Technology

References

  1. Scholz T. Family Opisthorchiidae Looss, 1899. In: Bray RA, Gibson DI, Jones A, editors. Keys to the Trematoda, Vol. 3. Wallinford: CAB international and the Natural History Museum; 2008. p. 9–49.Google Scholar
  2. Petney TN, Andrews RH, Saijuntha W, Wenz-Mücke A, Sithithaworn P. The zoonotic, fish-borne liver flukes Clonorchis sinensis, Opisthorchis felineus and Opisthorchis viverrini. Int J Parasitol. 2013;43(12–13):1031–46.View ArticlePubMedGoogle Scholar
  3. Doanh PN, Nawa Y. Clonorchis sinensis and Opisthorchis spp. in Vietnam: current status and prospects. Trans R Soc Trop Med Hyg. 2016;110(1):13–20.View ArticlePubMedGoogle Scholar
  4. Dao TT, Bui TV, Abatih EN, Gabriël S, Nguyen TT, Huynh QH, et al. Opisthorchis viverrini infections and associated risk factors in a lowland area of Binh Dinh Province, Central Vietnam. Acta Trop 2016;157:151–157.Google Scholar
  5. Dao TH, Nguyen TG, Victor B, Gabriël S, Dorny P. Opisthorchis viverrini-like liver fluke in birds from Vietnam: morphological variability and rDNA/mtDNA sequence confirmation. J Helminthol. 2014;88(4):441–6.View ArticlePubMedGoogle Scholar
  6. Dao HT, Abatih EN, Nguyen TT, Tran HT, Gabriël S, Smit S, et al. Prevalence of Opisthorchis viverrini-like fluke infection in ducks in Binh Dinh Province, Central Vietnam. Korean J Parasitol. 2016;54(3):357–61.View ArticlePubMedPubMed CentralGoogle Scholar
  7. Nawa Y, Doanh PN, Thaenkham UI. Opisthorchis viverrini an avian liver fluke? J Helminthol. 2015;89(2):255–6.View ArticlePubMedGoogle Scholar
  8. Oshmarin PG. Helminths of animals of Southeast Asia. In: Oshmarin PG, Mamaev YL, Lebedev BI, editors. Trematodes of domesticated and wild birds in the Democratic Republic of Vietnam. Moscow: Nauka; 1970. p. 5–126. (In Russian).Google Scholar
  9. Le NT. [Fauna of Vietnam.] Hanoi: Science and Techniques Publishing House. (In Vietnamese); 2000. p. 236–46.Google Scholar
  10. Tan ND, Thoai NV, Phuong TH. Development of egg and larvae of Opisthorchis parageminus in environment and in intermediate host. J Vet Sci Techn. 2017;3:58–63. (In Vietnamese with English abstract)Google Scholar
  11. Dorny P, Dao T, Victor B, Nguyen T, Gabriël S. Response to manuscript 'Is Opisthorchis viverrini an avian liver fluke? J Helminthol. 2015;89(2):257–8.View ArticlePubMedGoogle Scholar
  12. Le TH, Nguyen KT, Nguyen NT, Doan HT, Dung DT, Blair D. The ribosomal transcription units of Haplorchis pumilio and H. taichui and the use of 28S rDNA sequences for phylogenetic identification of common heterophyids in Vietnam. Parasit Vectors. 2017;10(1):17.View ArticlePubMedPubMed CentralGoogle Scholar
  13. Olson PD, Cribb TH, Tkach VV, Bray RA, Littlewood DTJ. Phylogeny and classification of the Digenea (Platyhelminthes: Trematoda). Int J Parasitol. 2003;33:733–55.View ArticlePubMedGoogle Scholar
  14. Kostadinova A, Pérez-del-Olmo A. The systematics of the Trematoda. In: Toledo F, Fried B, editors. Digenetic Trematodes. Advances in Experimental Medicine and Biology. New York: Springer Science + Business Media; 2014. p. 21–44.Google Scholar
  15. Tkach VV, Kudlai O, Kostadinova A. Molecular phylogeny and systematics of the Echinostomatoidea Looss, 1899 (Platyhelminthes: Digenea). Int J Parasitol. 2016;46:171–85.View ArticlePubMedGoogle Scholar
  16. Shekhovtsov SV, Katokhin AV, Kolchanov NA, Mordvinov VA. The complete mitochondrial genomes of the liver flukes Opisthorchis felineus and Clonorchis sinensis (Trematoda). Parasitol Int. 2010;59(1):100–3.View ArticlePubMedGoogle Scholar
  17. Thaenkham U, Nawa Y, Blair D, Pakdee W. Confirmation of the paraphyletic relationship between families Opisthorchiidae and Heterophyidae using small and large subunit ribosomal DNA sequences. Parasitol Int. 2011;60(4):521–3.View ArticlePubMedGoogle Scholar
  18. Thaenkham U, Blair D, Nawa Y, Waikagul J. Families Opisthorchiidae and Heterophyidae: are they distinct? Parasitol Int. 2012;61(1):90–3.View ArticlePubMedGoogle Scholar
  19. Cai XQ, Liu GH, Song HQ, CY W, Zou FC, Yan HK, et al. Sequences and gene organization of the mitochondrial genomes of the liver flukes Opisthorchis viverrini and Clonorchis sinensis (Trematoda). Parasitol Res. 2012;110(1):235–43.View ArticlePubMedGoogle Scholar
  20. Dao HT, Dermauw V, Gabriël S, Suwannatrai A, Tesana S, Nguyen GT, Dorny P. Opisthorchis viverrini infection in the snail and fish intermediate hosts in Central Vietnam. Acta Trop. 2017;170:120–5.View ArticlePubMedGoogle Scholar
  21. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol. 2013;30:2725–9.View ArticlePubMedPubMed CentralGoogle Scholar
  22. Na L, Gao JF, Liu GH, Fu X, Su X, Yue DM, et al. The complete mitochondrial genome of Metorchis orientalis (Trematoda: Opisthorchiidae): comparison with other closely related species and phylogenetic implications. Infect Genet Evol. 2016;39:45–50.View ArticlePubMedGoogle Scholar
  23. Sripa B, Brindley PJ, Mulvenna J, Laha T, Smout MJ, Mairiang E, et al. The tumorigenic liver fluke Opisthorchis viverrini - multiple pathways to cancer. Trends Parasitol. 2012;28:395–407.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Lee D, Choe S, Park H, Jeon HK, Chai JY, Sohn WM, et al. Complete mitochondrial genome of Haplorchis taichui and comparative analysis with other trematodes. Korean J Parasitol. 2013;51(6):719–26.View ArticlePubMedPubMed CentralGoogle Scholar
  25. Le TH, Blair D, McManus DP, Complete DNA. Sequence and gene organization of the mitochondrial genome of the liver fluke, Fasciola hepatica L. (Platyhelminthes; Trematoda). Parasitology. 2001;123(6):609–21.View ArticlePubMedGoogle Scholar
  26. Liu GH, Gasser RB, Young ND, Song HQ, Ai L, Zhu XQ. Complete mitochondrial genomes of the 'intermediate form' of Fasciola and Fasciola gigantica, and their comparison with F. hepatica. Parasit Vectors. 2014;7:150.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Ma J, Sun MM, He JJ, Liu GH, Ai L, Chen MX, Zhu XQ. Fasciolopsis buski (Digenea: Fasciolidae) from China and India may represent distinct taxa based on mitochondrial and nuclear ribosomal DNA sequences. Parasit Vectors. 2017;10(1):101.View ArticlePubMedPubMed CentralGoogle Scholar
  28. Ma J, He JJ, Liu GH, Leontovyč R, Kašný M, Zhu XQ. Complete mitochondrial genome of the giant liver fluke Fascioloides magna (Digenea: Fasciolidae) and its comparison with selected trematodes. Parasit Vectors. 2016;9(1):429.View ArticlePubMedPubMed CentralGoogle Scholar
  29. Littlewood DT, Lockyer AE, Webster BL, Johnston DA, Le TH. The complete mitochondrial genomes of Schistosoma haematobium and Schistosoma spindale and the evolutionary history of mitochondrial genome changes among parasitic flatworms. Mol Phylogenet Evol. 2006;39(2):452–67.View ArticlePubMedGoogle Scholar
  30. Thaenkham U, Dekumyoy P, Komalamisra C, Sato M, Dung do T, Waikagul J. Systematics of the subfamily Haplorchiinae (Trematoda: Heterphyidae), based on nuclear ribosomal DNA genes and ITS2 region. Parasitol Int. 2010;59(3):460–5.View ArticlePubMedGoogle Scholar
  31. Pornruseetairatn S, Kino H, Shimazu T, Nawa Y, Scholz T, Ruangsittichai J, et al. A molecular phylogeny of Asian species of the genus Metagonimus (Digenea) - small intestinal flukes - based on representative Japanese populations. Parasitol Res. 2016;115(3):1123–30.Google Scholar
  32. Le TH, Nguyen VD, Phan BU, Blair D, McManus DP. Case report: unusual presentation of Fasciolopsis buski in a Vietnamese child. Trans R Soc Trop Med Hyg. 2004;98(3):193–4.View ArticlePubMedGoogle Scholar
  33. Lotfy WM, Brant SV, DeJong RJ, Le TH, Demiaszkiewicz A, Rajapakse RP, et al. Evolutionary origins, diversification, and biogeography of liver flukes (Digenea, Fasciolidae). Am J Trop Med Hyg. 2008;79(2):248–55.PubMedPubMed CentralGoogle Scholar
  34. Johnston DA, Kane RA, Rollinson D. Small subunit (18S) ribosomal RNA gene divergence in the genus Schistosoma. Parasitology. 1993;107(2):147–56.View ArticlePubMedGoogle Scholar
  35. Lockyer AE, Olson PD, Ostergaard P, Rollinson D, Johnston DA, Attwood SW, et al. The phylogeny of the Schistosomatidae based on three genes with emphasis on the interrelationships of Schistosoma Weinland, 1858. Parasitology. 2003;126(3):203–24.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s). 2017

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Advertisement