Cells and parasites
Human foreskin fibroblast (HFF) cells were purchased from ATCC (SCRC-1041) and routinely maintained in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, BI, Israel), 100 µg/ml penicillin and 100 µg/ml streptomycin (Sigma, USA) and maintained in an incubator at 37 °C and 5% CO2. Toxoplasma gondii RH strain, green fluorescent protein-RH strain (GFP-RH), TgCtwh3 and TgCtwh6 were propagated in HFF cells.
RNA extraction and quantitative real-time PCR assays
Total RNA was extracted from the parasites using Trizol Reagent (Invitrogen, USA). Total RNA was used for reverse transcription with the cDNA synthesis kit (TaKaRa, Japan) according to the manufacture’s protocol. cDNA synthesis was performed using SYBR-Green Master Mix (TaKaRa, Japan). The primer sequences used were as follows:
TgMIC1 forward, TCGGTTTATGCTGAGTGTGC;
TgMIC1 reverse, GGCGAATTCCTTCCTCTTCT;
TgMIC4 forward, GACATGACGGGATCCAGAAC;
TgMIC4 reverse, CATGCAACTTGGCAGTCTGT;
TgMIC6 forward, CATATCACCTGCAAGCGTGT;
TgMIC6 reverse, GGCTCACGACTTTCACCTTC;
β-tublin forward, GTCTCCACTTCTTCCTCATTG;
β-tublin reverse, GTTCTTTGCGTCGAACATC.
β-Tublin was used as an internal control. Relative expression levels were calculated according to the standard 2−ΔΔCt method. All experiments were performed in triplicate and repeated at least three times.
Expression and purification of recombinant TgMIC1 proteins
The coding sequence (CDS) of TgMIC1 was optimized by using the Optigene™ codon optimized analysis platform (Shanghai Jierui Bioengineering Co., Ltd.). The optimized TgMIC1 sequence was synthesized and cloned into pET30a. The recombinant pET30a-MIC1 plasmid was transformed into Escherichia coli BL21 (DE3), cultivated in Luria-Bertani (LB) at 37 °C. The recombinant protein expression was induced by adding 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG, Sigma, USA) at 16 °C overnight with constant shaking at 200 rpm. Then, the bacterial cells were harvested by centrifugation at 8000 rpm for 6 min and resuspended in 20 ml 10 mM Tris–HCL buffer. The bacteria suspension was sonicated on ice (500 W, 180 times, 5 s each time, 5 s interval). The lysate was centrifuged at 12,000 rpm for 10 min to separate the supernatant and bacterial debris. The level of rTgMIC1 expression was analyzed by 12% SDS-PAGE. Furthermore, the separated supernatants were collected and purified by Ni column (Ni Sepharose 6 Fast Flow, GE Healthcare). The purification efficiency was analyzed via 12% SDS-PAGE and the protein concentration measured by BCA Protein Quantitation Kit according to the instruction's protocol.
TgMIC1 polyclonal antibody preparation and specific identification
For polyclonal antibody production, three 2-kg New Zealand white rabbits were immunized with 400 µg of purified rTgMIC1 diluted in 200 µl phosphate-buffered saline (PBS) and mixed with an equal volume of complete Freund’s adjuvant (Sigma, USA), through multiple intradermal injections into the back of each rabbit. Two weeks later, the immunization was boosted with 200 µg rTgMIC1 protein in Freund's incomplete adjuvant followed by a booster immunization once every 2 weeks. The ear vein blood was collected 7 days after the fourth immunization to measure the titer of antibodies by enzyme-linked immunosorbent assay (ELISA). All rabbits were anesthetized by injecting 3% pentobarbital sodium (1 ml/kg) at the base of the ear prior to the terminal cardiac puncture. The rabbit heart was then bled, and the antibodies were purified by Protein A [18]. The serum was mixed with an equal volume of the binding buffer to equilibrate the column. After the serum sample was loaded, the column was rinsed with binding buffer until the binding solution contained no protein. The presence of TgMIC1 polyclonal antibody was further identified by western blot and immunofluorescence assays.
Protein isolation and western blot assays
The rTgMIC1 and recombinant plasmid were prepared as described above. Parasites was lysed in the ice-cold RIPA lysis buffer (Beyotime, China) with 1% phenyl methyl sulfonyl fluoride, and the total protein concentrations were detected by BCA Protein Quantitation Kit. The proteins (20 µg) were subjected to electrophoresis in 8–10% polyacrylamide gel. The proteins were transferred onto a polyvinylidene fluoride membrane (Millipore, USA) by a standard western blot procedure. The membrane was blocked with 5% nonfat skim milk in TBS containing 0.1% Tween 20 for 1 h and incubated with specific primary antibodies against TgMIC1 (1:4000), Tgβ-actin (1:2000) or HIS monoclonal antibodies (1:5000) at 4 °C overnight. Following incubation with the corresponding secondary antibodies (Santa Cruz Biotechnology, 1:10,000 diluted to 5% nonfat skim milk) conjugated to horseradish peroxidase for 1 h, the membranes were visualized using ECL Western blotting substrate (Bio-RAD, USA). The band intensity was quantified using ImageJ software, and the TgMIC1 protein expression was normalized to the Tgβ-actin protein level.
ELISA analysis
The titer in the serum from immunized rabbits was performed with ELISA. The purified rMIC1 protein (200 ng/ml) was used to coat the plate at 4 °C overnight, followed by blocking with 5% BSA at 37 °C for 60 min. The serum sample was serially diluted from 1:200 to 1:204,800, and then 100 µl of diluted sample was added to each well and incubated 60 min at 37 °C. The samples were further incubated with secondary anti-rabbit antibodies (Zhongshan Golden Bridge, Beijing, China) diluted 1:5000 in PBS conjugated to horseradish peroxidase in each well for 1 h. Then, the wells were incubated with 100 µl tetramethylbenzidine (TMB, Beyotime, China) at 37 °C for 10 min. Finally, 2 M H2SO4 (50 µl) was used to stop the reaction in the well, and the absorbance was read at 450 nm. All results were repeated three to four times independently.
Immunofluorescence staining
HFF monolayers were grown on coverslips placed in wells of a 6-well plate at a density of 105 cells per well and were incubated for 24 h. Then, cells were challenged with T. gondii GFP-RH strains for 24 h. After washing with PBS three times, the coverslips were fixed with 4% paraformaldehyde (PFA) for 20 min. The coverslips were permeabilized with 0.1% Triton X-100 (Sigma, USA) for 30 min, and blocked for 30 min at 37 °C with 5% BSA in PBS. After washing again, the coverslips were then incubated with polyclonal antibody against TgMIC1 (1:1,000) overnight at 4 °C, followed by goat anti-rabbit secondary antibodies conjugated to Alexa Fluor 594 (1:500, Invitrogen, USA). Images were recorded using a Zeiss LSM880 confocal microscope (Zeiss).
Invasion assay
HFF monolayers were grown on coverslips placed in wells of a 6-well plate at a density of 105 cells per well and were incubated for 24 h. First, cells were incubated with TgMIC1 polyclonal antibody at 37 °C for 16 h. Then, the cells were challenged with T. gondii TgCtwh3 and TgCtwh6 strains for 1 h. Non-adherent parasites were washed away with PBS before fixation with 4% PFA for 20 min. Adherent external parasites were detected using rabbit anti-T. gondii glide-associated protein 45 (TgGAP45) antibodies (1:2000, gifted by Doctor Yonggen Jia, Department of Microbiology and Molecular Medicine, CMU, University of Geneva, Geneva 4, Switzerland) [19] followed by secondary anti-rabbit antibodies coupled to Alexa Fluor 488. After permeabilization with 0.1% Triton X-100 for 30 min, intracellular and adherent external parasites were labeled with anti-GAP45 antibodies followed by secondary anti-rabbit antibodies coupled to Alexa Fluor 594. Data were compiled from three independent experiments. Ten fields were randomly selected in the same pattern (the operator moved the microscope stage without viewing the sample) for all samples, and the number of external and internal parasites was counted in a blinded manner.
Intracellular growth assay
HFF monolayers were incubated with TgMIC1 polyclonal antibody at 37 °C for 16 h. The TgCtwh3 or TgCtwh6 parasites were allowed to invade HFF cells for 24 h. After washing with PBS three times, the coverslips were fixed with methyl alcohol for 5 min followed by the Wright Giemsa method and observed under a microscope. Fifty PVs were randomly selected, and the number of T. gondii tachyzoites in each PV was counted.
Statistical analysis
Statistical results are shown with values expressed as means ± standard deviation of at least three independent experiments. The statistical significance of differences was performed using one-way ANOVA and t-test. Values of p < 0.05 were considered statistically significant.
