Skip to content

Advertisement

  • Research
  • Open Access

Exploiting genetic polymorphisms in metabolic enzymes for rapid screening of Leishmania infantum genotypes

Contributed equally
Parasites & Vectors201811:572

https://doi.org/10.1186/s13071-018-3143-7

  • Received: 14 July 2018
  • Accepted: 10 October 2018
  • Published:

Abstract

Background

Leishmania infantum is the aetiological agent of visceral leishmaniasis (VL) and cutaneous leishmaniasis (CL). Numerous strains and/or zymodemes have been identified and characterized by multilocus enzyme electrophoresis (MLEE). MLEE is considered the reference method for L. infantum parasite typing and it is based upon enzyme electrophoretic mobility analysis from promastigote cultures. However, the MLEE technique is cumbersome, time-consuming and does not detect silent genetic mutations or nucleotide changes that give rise to amino acid changes that do not alter electrophoretic mobility. As a result of these difficulties, many DNA-based typing methods have been developed over the past few years. However, relative to the enzymes utilized in MLEE analysis, we observed a shortage of DNA sequences available in the GenBank database or an absolute lack of sequences belonging to specific zymodemes. The aims of the present study were to (i) implement the number of sequences coding for metabolic enzymes used in MLEE; (ii) identify polymorphisms that characterize L. infantum zymodemes most prevalent in the Mediterranean basin; and (iii) exploit these polymorphisms to develop a rapid screening test that would give results comparable with existing MLEE typing.

Results

Partial sequences of seven metabolic enzyme genes (malic enzyme, 6-phosphogluconate dehydrogenase, mitochondrial isocitrate dehydrogenase, glucose-6-phosphate isomerase, glucose-6-phosphate dehydrogenase, phosphoglucomutase and mannose phosphate isomerase) were obtained from 11 L. infantum strains. The comparison of these sequences with those obtained from GenBank allowed for the identification of a few polymorphisms that could distinguish several zymodemes. In particular, the polymorphism 390T>G in the malic enzyme gene has been exploited to develop a high-resolution melt (HRM)-based assay to rapidly differentiate the genotype 390T, associated with zymodemes MON-1, MON-72 and MON-201, evidencing a partial agreement between genotyping results and MLEE. The assay has been successfully applied to L. infantum clinical isolates and clinical samples.

Conclusions

A HRM-based assay for rapid identification of genotypes associated with the most common L. infantum zymodemes in the Mediterranean basin has been developed and its potential application in epidemiological research for L. infantum population screening, without parasite isolation and culturing, has been demonstrated.

Keywords

  • Leishmania infantum
  • Isoenzymes
  • Zymodeme
  • MON
  • HRM
  • Malic enzyme
  • SNP

Background

The taxonomy of the genus Leishmania is complex and has been revised several times in light of parasite biology and biochemistry [1, 2]. Currently, the genus Leishmania includes four subgenera: Leishmania, Viannia, Sauroleishmania and L. enriettii complex. Each subgenus includes several species [1]. Leishmania infantum, the aetiological agent of visceral leishmaniasis (VL) and cutaneous leishmaniasis (CL), belongs to subgenus Leishmania [3].

Multilocus enzyme electrophoresis (MLEE) is the isoenzymatic analysis presently considered the reference method for parasite typing by the World Health Organization [4]. This technique, developed at the Centre for Leishmaniasis of Montpellier (France), is based on the electrophoretic mobility of several enzymes obtained from promastigote culture, as described by Rioux et al. [5]. Up to 15 enzymes can be considered in this analysis: malate dehydrogenase, malic enzyme, isocitrate dehydrogenase (NADP), phosphogluconate dehydrogenase, glucose-6-phosphate dehydrogenase, glutamate dehydrogenase, cytochrome-b5 reductase, purine-nucleoside phosphorylase 1 and 2, glutamic-oxaloacetic transaminase 1 and 2, phosphoglucomutase, fumarase, mannose-6-phosphate isomerase, and glucose-6-phosphate isomerase [6]. The comparison of isoenzyme mobility with a reference strain identified over 300 zymodemes, also termed MON.

Concerning L. infantum, 45 zymodemes have been found, 36 recognized as real zymodemes and 9 as variants [6]. In dogs in the Mediterranean area, 12 zymodemes have been found: MON-1, MON-24, MON-34, MON-72, MON-77, MON-80, MON-98, MON-105, MON-108, MON-199, MON-199 variant NP1130 and MON-281. With the exception of MON-105, these zymodemes have also all been found in humans [6]. Other zymodemes, such as MON-11, MON-27, MON-28, MON-29 MON-33 and MON-189, have been isolated only from humans [7]. Leishmania infantum MON-1 is the most frequent zymodeme in both humans and dogs in the Mediterranean basin [8] and in the New World [9]. It is present in 30 countries and represents about 70% of all identified strains. In particular, MON-1 represents 88% of L. infantum zymodemes in the south of France [10], 96.7% in Portugal [11] and 45–58% in Spain [12, 13]. Moreover, in HIV-infected subjects, MON-1 was found in about 73% of co-infections, while in immunocompetent patients it was found in about 90% of VL cases and 20% of CL cases [14]. Concerning canine infections in Italy, Gramiccia et al. [15] showed a high prevalence of MON-1 zymodeme (91%) in 497 canine clinical isolates, with the remaining percentage composed almost exclusively of MON-72 zymodeme. The homogeneity of the isoenzymes identified in the dog population does not fully reflect the isoenzyme diversity in humans; therefore, the role of canine population as the only reservoir for all L. infantum zymodemes remains unclear. In light of this epidemiological evidence, it is advisable that a more extensive typing of L. infantum be carried out. However, MLEE presents several disadvantages: it is time-consuming, technically demanding, and requires bulk cultures of parasites. Moreover, due to its inability to detect nucleotide substitutions that do not change the amino acid composition, its discriminatory power is poor. Therefore, molecular approaches such as multilocus microsatellite typing (MLMT) [16, 17] and multilocus sequence typing (MLST) [1820] have been introduced for strain discrimination. MLST results were generally in agreement with MLEE, though increased resolution was obtained and some key discrepancies were found [1821]. For example, L. infantum zymodeme MON-1 has been shown to be genetically heterogeneous. On the other hand, it was also shown that strains classified as different zymodemes can present the same genotype [18, 20]. However, the low number of typed strains and the lack of consensus on the marker genes, as well as the lack of MLST database for Leishmania, have hindered the implementation of MLST as a reference typing method [22]. Until now, most of the epidemiological data available in the literature is based on MLEE classification, and many DNA-based typing methods correlate data with existing MLEE classification [23, 24].

In this study, we explored the sequences of seven L. infantum genes encoding enzymes considered in MLEE analysis with the aim of (i) enriching the actual databases; (ii) identifying polymorphisms that characterize L. infantum zymodemes most prevalent in the Mediterranean basin; and (iii) developing a rapid screening test that would give results that could be associated with existing MLEE data, overcoming the drawbacks of this laborious technique.

Methods

Leishmania infantum DNA

Leishmania infantum strains or isolates used in this study are listed in Table 1. The Chelex-purified DNA from promastigotes of L. infantum strains or isolates was obtained from the National Reference Center for Leishmaniasis (C.Re.Na.L.), Istituto Zooprofilattico Sperimentale della Sicilia (Palermo, Italy). The DNA was quantified using a Qubit fluorometer (Life Technologies, Carlsbad, USA).
Table 1

Leishmania infantum strains/isolates used in this study

Species

Strain or clinical isolate

Zymodeme

L. infantum

MHOM/TN/80/IPT1

MON-1

L. infantum

MHOM/FR/78/LEM75

MON-1

L. infantum

Clinical isolate V2921

MON-1

L. infantum

Clinical isolate 31U

MON-1

L. infantum

Clinical isolate 49U

MON-1

L. infantum

Clinical isolate 10816

MON-1

L. infantum

Clinical isolate 791

MON-1

L. infantum

MHOM/DZ/82/LIPA59

MON-24

L. infantum

MHOM/ES/81/BCN1

MON-29

L. infantum

MHOM/IT/86/ISS218

MON-72

L. infantum

MHOM/IT/93/ISS822

MON-201

L. infantum

Isolate 1

Not determined

L. infantum

Isolate 2

Not determined

Identification of molecular targets and PCR amplification

A preliminary in silico analysis was performed in the GenBank sequence database to search for genes encoding enzymes used in MLEE for L. infantum. These genes were selected not only to gain information on genetic diversity, but also to connect the genotyping results to the existing MLEE data. Six genes were initially selected, based on previous studies performed on L. infantum that allowed the retrieval of available polymorphic sequences from GenBank, i.e. malic enzyme (me), 6-phosphogluconate dehydrogenase (pgd), mitochondrial isocitrate dehydrogenase (icd), glucose-6-phosphate isomerase (gpi), glucose-6-phosphate dehydrogenase (g6pdh) and mannose phosphate isomerase (mpi). Moreover, the phosphoglucomutase (pgm) gene was also taken into consideration in an attempt to enrich the existing database. Primers were designed with Primer-BLAST [25] using L. infantum MHOM/FR/78/LEM75 or MCAN/AR/10/MDP1 sequences as reference. The primers are listed in Table 2 and their position on the seven target genes are shown in Additional file 1: Figure S1.
Table 2

Primers used in this study

Target gene

GenBank ID

Forward primer (5'-3')

Reverse primer (5'-3')

Amplicon length (bp)

Malic enzymea

DQ449701.1

GAGCCGATCAACCGCTATCA

TCTTTCTTCATCCCGGCCTC

773

Malic enzymeb

DQ449701.1

GGTGTGGCGGAGAGCATC

TTGTTGCCTTGCGATGGTTG

458

Malic enzymec

DQ449701.1

TCAGAACCTTCGCAAGACGA

CACTTGCCGATGCTGATGC

111

Phosphogluconate dehydrogenase

AM157139.1

TTCGGCTTCGACAACGATCA

CGAGGGAAGTTGGGGAATG

306

Mitochondrial isocitrate dehydrogenase

DQ449672.1

CTCCAGCACCAACGTCTACC

TACATGCGCTGGAAGGTCTG

708

Glucose-6-phosphate isomerase

AJ620617.1

CATTCACCAGGGCACCAAGA

TGATCGGAGACGATGTTGCC

426

Glucose-6-phosphate dehydrogenase

DQ449770.1

ATGTCGGAAGAGCAGTCTCA

CTCCTTCCCGAGGTAGTGGT

765

Phosphoglucomutase

KJ643214.1

GGAGACGGTTAAGATTACGCAC

TATGCTTCATCGCGGGGTT

413

Mannose phosphate isomerase

DQ449737.1

TTTGCGGAGTTGTGGGTAGG

CTCGCTGCTCTTCTTCTCGT

864

a5' region

b3' region

cInternal region

Conventional PCR was performed on a total volume of 50 μl with 1–2 μl of template, 200 μM dNTP, 2.5 mM MgCl2, 200 nM of each primer and 1 unit of Hot-Rescue DNA polymerase (Diatheva s.r.l., Fano, Italy). The amplification was performed in a PCR GeneAmp 2700 thermocycler (Applied Biosystems, Foster City, USA). The thermal cycling profile was as follows: 94 °C for 7 min; followed by 35 cycles at 94 °C for 30 s, 60 °C for 20 s or 60 s (depending on amplicon length) and 72 °C for 20 s; with a final extension at 72 °C for 5 min. Each sample was amplified in duplicate. Amplified fragments were analyzed by agarose gel electrophoresis and visualized with GelRed DNA stain (Biotium, Fremont, USA). The gels were visualized under UV light using a gel doc apparatus (Bio-Rad, Hercules, USA). A 100-bp double-stranded DNA ladder or ΦX174 DNA/BSU/ HaeIII/marker 9 (MBI Fermentas, Waltham, USA) was included on the gels as a size standard.

PCR product sequencing and phylogenetic analysis

The amplification products of me, pgd, icd, gpi, g6pdh, mpi and pgm genes for all the strains/isolates are indicated in Table 1 (with the exception of isolate 1 and isolate 2) were purified using a Minelute PCR purification kit (Qiagen, Hilden, Germany) and directly sequenced. DNA sequencing was performed using the BigDye Terminator v. 1.1 Cycle Sequencing Kit on an ABI PRISM 310 Genetic Analyzer (Applied Biosystems). Bases with Phred values < 20 were checked by visual analysis of electropherograms and aligned with BioEdit Sequence Alignment Editor [26] using default options. Heterozygosity was considered to be present when direct sequencing of PCR product yielded a similar peak at the same site. The sequences were deposited in GenBank with the following accession numbers: MF375413-MF375423 (me), MF280205-MF280215 (pgd), MF347625-MF347635 (icd), MF288905-MF288915 (gpi), MF479731-MF479741 (g6pdh), MF462101-MF462111 (mpi) and MF347614-MF347624 (pgm).

For each housekeeping gene, allele numbers were assigned to unique sequences and a genotype was determined as the combination of the six genes selected for analysis (Additional file 2: Table S1). In total, 54 isolates/strains belonging to 22 different MON, were analyzed; 23 of them had sequences available for me, pgd, icd, gpi, g6pdh and mpi genes. For each of these isolates/strains, we concatenated those sequences to obtain a 3578 bp-long sequence. A maximum likelihood tree was constructed from the concatenated nucleotide dataset using PhyML 3.0 [27]. The best-fit substitution model was determined by the Akaike information criterion (AIC) using Smart Model Selection [28]. The optimal model of evolution was GTR+I with proportion of invariable sites of 0.989 and one category for substitution rate. Bootstrap values were calculated from 100 replications. The tree was visualized using iTOL [29].

Real-time PCR and high resolution melting (HRM) analysis

A 111 bp internal region of the me gene encompassing the single nucleotide polymorphism (SNP) 390T>G was amplified with primers listed in Table 2. Real-time PCR (named qPCR-MEint) was carried out in a 25 μl volume with 1 μl template DNA and SYBR green PCR master mix (Diatheva s.r.l.) containing 1U Taq Polymerase and 200 nM of each primer. The PCR reactions were performed in a Rotor-Gene 6000 instrument (Corbett Life Science, Mortlake, Australia). The amplification profile was: 94 °C for 10 min; followed by 33 cycles at 94 °C for 30 s, 60 °C for 20 s and 72 °C for 20 s. The reactions were performed in duplicate. After amplification, the high-resolution melting (HRM) analysis was performed over the range 85–95 °C, rising by 0.1 °C/s and waiting for 2 s at each temperature. Raw HRM curves were normalized by the Rotorgene 6000 v.1.7 software. Difference graphs of the normalized curves were obtained using MHOM/FR/78/LEM75 and MHOM/DZ/82/LIPA59 strains as reference curves for genotypes 390T and 390G, respectively.

The qPCR-MEint and HRM analysis was also tested using DNA extracted from 4 clinical samples (whole blood, buffy coat, conjunctival swabs, bone marrow aspirate) as described previously [30, 31]. To ensure adequate sensitivity with these samples, a pre-amplification step (10 cycles) was performed and 2 μl of pre-amplified mixture were used as template in the qPCR described above.

Results

Sequence analyses

The L. infantum isolates/strains gave single products of expected size with the primer pairs listed in Table 2. The PCR products were sequenced and the sequences were aligned with those obtained from GenBank. Partial sequences of me, pgd, icd, gpi, g6pdh, mpi and pgm genes were obtained from 11 strains/isolates of L. infantum. Seven represented MON-1 zymodeme and the remaining four represented MON-24, MON-29, MON-72 and MON-201 (Table 1). Notably, the following L. infantum sequences from zymodemes not previously reported in the databases were obtained: me sequences from MON-24, MON-72 and MON-201; a pgd sequence from MON-201; icd sequences from MON-24, MON-72 and MON-201; gpi sequences from MON-24, MON-72 and MON-201; g6pdh sequences from MON-24, MON-72 and MON-201; mpi sequences from MON-24, MON-72 and MON-201; and pgm sequences from MON-1, MON-24, MON-29, MON-72 and MON-201.

Concerning the me gene, 13 SNPs were evidenced (Table 3). Nine were silent and four changed the amino acid sequence (V59M; I133S; V330I; E563E/D). These data confirmed previously reported findings obtained with L. donovani complex [19]. All sequences from MON-1 strains were identical, except for the MHOM/TN/80/IPT1 strain. Notably, the genotype heterogeneity of this strain was previously confirmed on the gpi sequence [18]. It is also noteworthy that the two MON-29 strains (MHOM/ES/82/BCN1 and MHOM/FR/1996/LEM3249) showed differences at nucleotide positions 327, 329 and 507, confirming the higher discriminatory power of a sequencing approach compared to MLEE. The pgd gene sequence showed only the silent SNP 678A>G in 11 strains (Table 4). Concerning the icd gene, it is of relevance that two silent SNPs (204T>C, 369T>C) were evidenced in strain MHOM/DZ/82/LIPA59 (MON-24) and three silent SNPs (150G>A, 369T>C, 1038C>A) in strain MHOM/SD/1997/LEM3472 (MON-267) (Table 5). The polymorphisms 204T>C and 1038C>A appeared unique for MON-24 and MON-267, respectively. The gpi gene sequence showed 1503G>T/K and 1831G>A/R SNPs in 4 and 5 strains, respectively (Table 6). The g6pdh gene showed 8 SNPs (Table 7). The mpi gene showed 5 SNPs (Table 8), with SNP 486G>A unique for MON-136. Finally, concerning the pgm gene, no differences were found among the zymodemes examined, including the two sequences available in the database.
Table 3

Polymorphisms in malic enzyme (me) gene

Zymodeme

Strain/isolate

GenBank ID

106

204

327

329

390

507

586

762

843

919

1182

1287

1620

MON-1

MHOM/FR/78/LEM75

DQ449701.1

G

C

C

T

T

T

C

C

C

G

A

C

G

MON-1

MHOM/ES/1993/PM1

DQ449703.1

.

.

.

.

.

.

.

.

.

.

.

.

.

MON-1

MHOM/FR/1995/LPN114

DQ449702.1

.

.

.

.

.

.

.

.

.

.

.

.

.

MON-1

MHOM/PT/2000/IMT260

DQ449706.1

.

.

.

.

.

.

.

.

.

.

.

.

.

MON-1

MHOM/FR/1997/LSL29

DQ449704.1

.

.

.

.

.

.

.

.

.

.

.

.

.

MON-1

MHOM/ES/1986/BCN16

DQ449705.1

.

.

.

.

.

.

.

.

.

.

.

.

.

MON-1

MHOM/BL/67/ITMAP263

KU175196.1

.

.

.

.

.

.

.

.

.

.

.

.

MON-1

MHOM/TN/80/IPT1

MF375413

.

.

.

G

.

.

.

.

MON-1

MHOM/FR/78/LEM75

MF375414

.

.

.

.

.

.

.

.

MON-1

Isolate 31U

MF375415

.

.

.

.

.

.

.

.

MON-1

Isolate 49u

MF375416

.

.

.

.

.

.

.

MON-1

Isolate 10816

MF375417

.

.

.

.

.

.

.

.

MON-1

Isolate 791

MF375418

.

.

.

.

.

.

.

.

MON-1

Isolate V2921

MF375419

.

.

MON-11

MHOM/FR/1980/LEM189

DQ449714.1

.

.

.

.

G

.

.

.

.

.

.

.

.

MON-24

MHOM/DZ/82/LIPA59

MF375420

T

.

G

G

G

.

.

T

MON-29

MHOM/ES/82/BCN1

MF375421

.

M

G

G

G

.

.

.

MON-29

MHOM/FR/1996/LEM3249

DQ449707.1

.

.

.

.

G

.

.

.

.

.

.

.

.

MON-72

MHOM/IT/86/ISS218

MF375422

.

.

.

.

.

.

.

.

.

.

.

MON-78

MHOM/MT/1985/BUCK

DQ449715.1

.

.

G

G

G

.

.

.

A

C

T

.

MON-81

MHOM/SD/1962/3Sa

DQ449718.1

.

.

G

G

G

A

G

.

A

.

.

.

MON-98

MHOM/GR/2001/GH6

DQ449728.1

.

.

.

.

G

.

.

.

.

.

.

.

.

MON-98

MCAN/GR/2001/GD8

DQ449729.1

.

.

.

.

G

.

.

.

.

.

.

.

.

MON-98

MHOM/GR/2003/GH15

DQ449730.1

.

.

.

.

G

.

.

.

.

.

.

.

.

MON-98

MHOM/GR/2003/GH16

DQ449731.1

.

.

.

.

G

.

.

.

.

.

.

.

.

MON-98

MHOM/GR/2003/GH18

DQ449732.1

.

.

.

.

G

.

.

.

.

.

.

.

.

MON-98

MHOM/GR/2003/GH20

DQ449733.1

.

.

.

.

G

.

.

.

.

.

.

.

.

MON-98

MHOM/GR/2004/GD17

DQ449734.1

.

.

.

.

G

.

.

.

.

.

.

.

.

MON-183

MHOM/ES/1991/LEM2298

DQ449708.1

.

.

.

.

G

.

.

.

.

.

.

.

.

MON-188

MHOM/IT/1993/ISS800

DQ449722.1

.

T

.

G

G

G

.

.

T

A

.

.

.

MON-198

MHOM/ES/1988/LLM175

DQ449719.1

.

.

.

.

G

.

.

.

.

.

.

.

.

MON-199

MHOM/ES/1992/LLM373

DQ449720.1

A

.

.

G

G

G

.

.

.

.

C

.

.

MON-201

MHOM/IT/93/ISS822

MF375423

.

.

.

.

.

.

.

.

.

.

.

.

MON-228

MHOM/IT/1994/ISS1036

DQ449721.1

.

.

.

.

G

.

.

.

.

.

.

.

S

MON-267

MHOM/SD/1997/LEM3472a

DQ449723.1

.

.

.

G

G

G

.

.

.

A

.

.

.

MON-309

ITOB/TR/2005/CUK2

EU545253.1

.

T

.

K

G

G

.

.

Y

A

.

.

.

MON-309

MHOM/TR/2005/CUK1

EU545252.1

.

T

.

G

G

G

.

.

T

A

.

.

.

ni

ITOB/TR/2007/CUK10

EU545254.1

.

T

.

K

G

G

.

.

Y

A

.

.

.

non-MON-1

MHOM/TR/2000/OG-VL

EU545255.1

.

.

.

.

G

.

.

.

.

.

.

.

.

ni

Isolate RRR-B

DQ449727.1

.

.

.

.

G

.

.

.

.

.

.

.

.

Zymodeme sequences obtained in this study are in bold

Abbreviation: ni not indicated

Key: . consensus sequence, – sequence not available

aInitially assigned to L. infantum and successively designated L. donovani [18]

Table 4

Polymorphisms in 6-phosphogluconate dehydrogenase (pgd)

Zymodeme

Strain/isolate

GenBank ID

194

678

747

MON-1

MHOM/FR/78/LEM75

AM157139.1

C

A

C

MON-1

MHOM/PT/2000/IMT260 (LEM3975)

AM157144.1

.

.

.

MON-1

MHOM/ES/1986/BCN16 (LEM1078)

AM157143.1

.

.

.

MON-1

MHOM/FR/1997/LSL29 (LEM3420)

AM157142.1

.

.

.

MON-1

MHOM/ES/1993/PM1 (LEM2608)

AM157141.1

.

.

.

MON-1

MHOM/FR/1995/LPN114 (LEM3001)

AM157140.1

.

.

.

MON-1

MHOM/TN/1980/IPT1

AM157736.1

.

.

.

MON-1

MHOM/TN/1980/IPT1

MF280205

.

.

MON-1

Isolate 31u

MF280206

.

.

MON-1

Isolate 49u

MF280207

.

.

MON-1

Isolate 791

MF280208

.

.

MON-1

Isolate 10816

MF280209

.

.

MON-1

MHOM/FR/78/LEM75

MF2802010

.

.

MON-1

Isolate V2921

MF2802011

.

.

MON-11

MHOM/FR/1980/LEM189

AM157151.1

.

G

.

MON-24

MHOM/DZ/82/LIPA59

MF2802012

G

.

MON-24

IARI/PT/1989/IMT171

AM157137.1

.

G

.

MON-27

MHOM/IT/1979/Francesca

AM157138.1

.

.

.

MON-29

MHOM/ES/82/BCN1

MF2802013

G

.

MON-29

MHOM/FR/1996/LEM3249

AM157145.1

.

G

.

MON-34

MHOM/CN/1980/A

AM157136.1

.

G

.

MON-72

MHOM/IT/86/ISS218

MF2802014

.

.

MON-78

MHOM/MT/1985/BUCK

AM157152.1

.

.

.

MON-81

MHOM/SD/1962/3Sa

AM157155.1

T

G

T

MON-183

MHOM/ES/1991/LEM2298

AM157146.1

.

G

.

MON-188

MHOM/IT/1993/ISS800

AM157159.1

.

G

.

MON-198

MHOM/ES/1988/LLM175

AM157156.1

.

G

.

MON-199

MHOM/ES/1992/LLM373

AM157157.1

.

G

.

MON-201

MHOM/IT/93/ISS822

MF2802015

.

.

MON-228

MHOM/IT/1994/ISS1036

AM157158.1

.

G

.

MON-267

MHOM/SD/1997/LEM3472a

AM157160.1

T

G

T

Zymodeme sequences obtained in this study are in bold

Key: . consensus sequence, – sequence not available

aInitially assigned to L. infantum and successively designated L. donovani [18]

Table 5

Polymorphisms in mitochondrial isocitrate dehydrogenase (icd)

Zymodeme

Strain/isolate

GenBank ID

150

204

369

1038

MON-1

MHOM/FR/78/LEM75

DQ449672.1

G

T

T

C

MON-1

MHOM/ES/1986/BCN16

DQ449676.1

.

.

.

.

MON-1

MHOM/FR/1997/LSL29

DQ449675.1

.

.

.

.

MON-1

MHOM/ES/1993/PM1

DQ449674.1

.

.

.

.

MON-1

MHOM/FR/1995/LPN114

DQ449673.1|

.

.

.

.

MON-1

MHOM/PT/2000/IMT260

DQ449677.1

.

.

.

.

MON-1

MHOM/TN/1980/IPT1

MF347625

.

.

.

MON-1

MHOM/FR/78/LEM75

MF347626

.

.

.

MON-1

Isolate 31u

MF347627

.

.

.

MON-1

Isolate 49u

MF347628

.

.

.

MON-1

Isolate 791

MF347629

.

.

.

MON-1

Isolate 10816

MF347630

.

.

.

MON-1

Isolate V2921

MF347631

.

.

.

MON-11

MHOM/FR/1980/LEM189

DQ449685.1

.

.

C

.

MON-24

MHOM/DZ/82/LIPA59

MF347632

.

C

C

MON-29

MHOM/ES/82/BCN1

MF347633

.

.

.

MON-29

MHOM/FR/1996/LEM3249

DQ449678.1

.

.

C

.

MON-72

MHOM/IT/86/ISS218

MF347634

.

.

.

MON-78

MHOM/MT/1985/BUCK

DQ449686.1

.

.

C

.

MON-81

MHOM/SD/1962/3Sa

DQ449689.1

A

.

C

.

MON-183

MHOM/ES/1991/LEM2298

DQ449679.1

.

.

.

.

MON-188

MHOM/IT/1993/ISS800

DQ449693.1

.

.

C

.

MON-198

MHOM/ES/1988/LLM175

DQ449690.1

.

.

.

.

MON-199

MHOM/ES/1992/LLM373

DQ449691.1

.

.

.

.

MON-201

MHOM/IT/93/ISS822

MF347635

.

.

.

MON-228

MHOM/IT/1994/ISS1036

DQ449692.1

.

.

C

.

MON-267

MHOM/SD/1997/LEM3472a

DQ449694.1

A

.

C

A

MON-309

ITOB/TR/2005/CUK2

EU545241.1

.

.

C

.

MON-309

MHOM/TR/2005/CUK1

EU545240.1

.

.

C

.

ni

ITOB/TR/2007/CUK10

EU545242.1

.

.

C

.

non-MON-1

MHOM/TR/2000/OG-VL

EU545243.1

.

.

.

.

ni

ni

DQ449698.1

.

.

.

.

Zymodeme sequences obtained in this study are in bold

Abbreviation: ni not indicated

Key: . consensus sequence, – sequence not available

aInitially assigned to L. infantum and successively designated L. donovani [18]

Table 6

Polymorphisms in glucose-6-phosphate isomerase (gpi)

Zymodeme

Strain/isolate

GenBank ID

703

1503

1807

1831

MON-1

MHOM/FR/1978/LEM75

AJ620617.1

T

G

C

G

MON-1

MHOM/TN/1980/IPT1

AJ620647.1

.

.

.

A

MON-1

MHOM/PT/2000/IMT260

AM157725.1

.

.

.

.

MON-1

MHOM/ES/1986/BCN16

AM157724.1

.

.

.

.

MON-1

MHOM/FR/1997/LSL29

AM157723.1

.

.

.

.

MON-1

MHOM/ES/1993/PM1

AM157722.1

.

.

.

.

MON-1

MHOM/FR/1995/LPN114

AM157721.1

.

.

.

.

MON-1

MHOM/TN/1980/IPT1

MF288905

.

MON-1

MHOM/FR/78/LEM75

MF288906

.

MON-1

Isolate 31u

MF288907

.

MON-1

Isolate 49u

MF288908

.

MON-1

Isolate 791

MF288909

.

MON-1

Isolate 10816

MF288910

.

MON-1

Isolate V2921

MF288911

.

MON-24

MHOM/DZ/82/LIPA59

MF288912

.

MON-27

MHOM/IT/1979/Francesca

AM117192.1

.

.

.

R

MON-29

MHOM/ES/82/BCN1

MF288913

.

MON-29

MHOM/FR/1996/LEM3249

AJ620618.1

.

.

.

.

MON-34

MHOM/CN/1980/A

AJ620637.1

.

.

.

A

MON-72

MHOM/IT/86/ISS218

MF288914

.

MON-78

MHOM/MT/1985/BUCK

AJ620619.1

.

.

.

A

MON-81

MHOM/SD/1962/3Sa

AJ620629.1

C

.

T

.

MON-183

MHOM/ES/1991/LEM2298

AJ620620.1

.

T

.

.

MON-198

MHOM/ES/1988/LLM175

AJ620630.1

.

T

.

.

MON-199

MHOM/ES/1992/LLM373

AJ620631.1

.

T

.

R

MON-201

MHOM/IT/93/ISS822

MF288915

.

MON-228

MHOM/IT/1994/ISS1036

AJ620632.1

.

K

.

.

MON-267

MHOM/SD/1997/LEM3472a

AJ620634.1

C

.

T

.

Zymodeme sequences obtained in this study are in bold

Key: . consensus sequence, – sequence not available

aInitially assigned to L. infantum and successively designated L. donovani [18]

Table 7

Polymorphisms in glucose-6-phosphate dehydrogenase (g6pdh)

Zymodeme

Strain/isolate

GenBank ID

45

315

348

359

403

468

690

1191

MON-1

MHOM/FR/78/LEM75

DQ449770.1

T

C

T

A

G

T

C

C

MON-1

MHOM/PT/2000/IMT260

DQ449775.1

.

.

.

.

.

.

.

.

MON-1

MHOM/ES/1986/BCN16

DQ449774.1

.

.

.

.

.

.

.

.

MON-1

MHOM/FR/1997/LSL29

DQ449773.1

.

.

.

W

.

.

.

.

MON-1

MHOM/ES/1993/PM1

DQ449772.1

.

.

.

.

.

.

.

.

MON-1

MHOM/FR/1995/LPN114

DQ449771.1

.

.

.

.

.

.

.

.

MON-1

MHOM/BL/67/ITMAP263

KU175220.1

.

.

.

.

.

.

.

MON-1

MHOM/TN/80/IPT1

MF479731

.

.

.

.

.

.

.

MON-1

MHOM/FR/78/LEM75

MF479732

.

.

.

MON-1

Isolate 49u

MF479733

.

.

.

.

.

.

.

MON-1

Isolate 31U

MF479734

.

.

.

.

MON-1

Isolate 791

MF479735

.

.

.

.

.

.

.

MON-1

Isolate 10816

MF479736

.

.

.

.

.

.

.

MON-1

Isolate V2921

MF479737

.

.

.

.

.

.

.

MON-11

MHOM/FR/1980/LEM189

DQ449783.1

C

.

.

T

.

.

.

.

MON-24

MHOM/DZ/82/LIPA59

MF479738

C

.

.

.

.

.

.

MON-29

MHOM/ES/82/BCN1

MF479739

C

.

.

T

.

.

.

MON-29

MHOM/FR/1996/LEM3249

DQ449776.1

C

.

.

W

.

.

.

MON-72

MHOM/IT/86/ISS218

MF479740

.

.

.

.

.

.

.

MON-77

MCAM/ES/86/LEM935

DQ449797.1

.

.

.

W

.

.

.

MON-78

MHOM/MT/1985/BUCK

DQ449784.1

C

.

.

.

.

.

.

.

MON-81

MHOM/SD/1962/3Sa

DQ449787.1

C

G

C

.

.

.

T

T

MON 105

MHOM/ES/2001/LLM1026

DQ449799.1

.

.

.

.

.

.

.

.

MON-183

MHOM/ES/1991/LEM2298

DQ449777.1

.

.

.

W

.

.

.

.

MON-188

MHOM/IT/1993/ISS800

DQ449791.1

C

.

.

.

.

.

.

.

MON-198

MHOM/ES/1988/LLM175

DQ449788.1

C

.

.

T

.

.

.

.

MON-199

MHOM/ES/1992/LLM373

DQ449789.1

.

.

.

W

.

.

.

.

MON-201

MHOM/IT/93/ISS822

MF479741

.

.

.

.

.

.

.

.

MON-228

MHOM/IT/1994/ISS1036

DQ449790.1

.

.

.

.

.

.

.

.

MON-253

MHOM/ES/1996/LLM580

DQ449798.1

.

.

.

.

A

.

.

.

MON-267

MHOM/SD/1997/LEM3472a

DQ449792.1

C

G

C

.

.

.

T

T

MON-267

MCAN/SD/2000/LEM3988

KU175214.1

G

C

.

.

.

T

.

MON-309

ITOB/TR/2005/CUK2

EU545237.1

C

.

.

.

.

.

.

.

MON-309

MHOM/TR/2005/CUK1

EU545236.1

C

.

.

.

.

.

.

.

ni

ITOB/TR/2007/CUK10

EU545238.1

C

.

.

.

.

.

.

.

ni

MHOM/CN/93/KXG-XU

JX021334.1

.

C

.

.

C

.

.

ni

MHOM/CN/94/KXG-LIU

JX021333.1

.

C

.

.

C

.

.

non-MON-1

MHOM/TR/2000/OG-VL

EU545239.1

.

.

.

.

.

.

.

.

ni

Isolate RRR-B

DQ449796.1

.

.

.

.

.

.

.

.

ni

MHOM/PA/78/WR285

KU175216.1

.

.

.

.

.

.

.

ni

Isolate D38

KU175221.1

.

.

.

.

.

.

.

ni

Isolate D33

KU175219.1

.

.

.

.

.

.

.

ni

Isolate D36D

KU175218.1

.

.

.

.

.

.

.

ni

Isolate E9D

KU175217.1

.

.

.

.

.

.

.

ni

JPCM5

XM_001468358.1

.

.

.

.

.

.

.

.

Zymodeme sequences obtained in this study are in bold

Abbreviation: ni not indicated

Key: . consensus sequence, – sequence not available

aInitially assigned to L. infantum and successively designated L. donovani [18]

Table 8

Polymorphisms in mannose phosphate isomerase (mpi)

Zymodeme

Strain/isolate

GenBank ID

300

392

486

637

798

MON-1

MHOM/FR/1978/LEM75

DQ449737.1

C

A

G

A

C

MON-1

MHOM/FR/1995/LPN114

DQ449738.1

.

.

.

.

.

MON-1

MHOM/ES/1993/PM1

DQ449739.1

.

.

.

.

.

MON-1

MHOM/FR/1997/LSL29

DQ449740.1

.

.

.

.

.

MON-1

MHOM/ES/1986/BCN16

DQ449741.1

.

.

.

.

.

MON-1

MHOM/PT/2000/IMT260

DQ449742.1

.

.

.

.

.

MON-1

MHOM/TN/1980/IPT1

MF462101

.

.

.

.

.

MON-1

MHOM/FR/78/LEM75

MF462102

.

.

.

MON-1

Isolate 31u

MF462103

.

.

.

.

.

MON-1

Isolate 791

MF462104

.

.

.

.

.

MON-1

Isolate 10816

MF462105

.

.

.

.

MON-1

Isolate V2921

MF462106

.

.

.

.

.

MON-1

Isolate 49u

MF462107

.

.

.

.

.

MON-11

MHOM/FR/1980/LEM189

DQ449750.1

.

.

.

.

.

MON-24

MHOM/DZ/82/LIPA59

MF462108

.

.

.

.

.

MON-29

MHOM/ES/81/BCN1

MF462109

.

.

.

.

.

MON-29

MHOM/FR/1996/LEM3249

DQ449743.1

.

.

.

.

.

MON-72

MHOM/IT/86/ISS218

MF462110

.

.

.

.

.

MON-78

MHOM/MT/1985/BUCK

DQ449751.1

.

.

.

.

.

MON-81

MHOM/SD/1962/3Sa

DQ449754.1

.

.

.

.

.

MON-136

MHOM/IT/1990/ISS510

DQ449766.1

.

.

A

R

.

MON-183

MHOM/ES/1991/LEM2298

DQ449744.1

.

.

.

.

.

MON-188

MHOM/IT/1993/ISS800

DQ449758.1

.

.

.

G

.

MON-198

MHOM/ES/1988/LLM175

DQ449755.1

.

.

.

.

.

MON-199

MHOM/ES/1992/LLM373

DQ449756.1

.

.

.

.

.

MON-201

MHOM/IT/93/ISS822

MF462111

.

.

.

R

.

MON-228

MHOM/IT/1994/ISS1036

DQ449757.1

.

.

.

.

.

MON-267

MHOM/SD/1997/LEM3472a

DQ449759.1

T

R

.

.

T

non-MON-1

MHOM/TR/2000/OG-VL

EU545251.1

.

.

.

.

.

ni

MHOM/TR/2005/CUK1

EU545248.1

.

.

.

.

.

ni

ITOB/TR/2005/CUK2

EU545249.1

.

.

.

.

.

ni

ITOB/TR/2007/CUK10

EU545250.1

.

.

.

.

.

ni

MHOM/CN/94/KXG-LIU

JX021373.1

T

.

.

.

T

ni

MHOM/CN/93/KXG-XU

JX021374.1

T

.

.

.

T

ni

Isolate RRR-B

DQ449763.1

Y

.

.

.

Y

Zymodeme sequences obtained in this study are in bold

Abbreviation: ni not indicated

Key: . consensus sequence, – sequence not available

aInitially assigned to L. infantum and successively designated L. donovani [18]

The concatenated partial sequences for me, pgd, icd, gpi, g6pdh, mpi from 23 strains were used for phylogenetic tree construction (Fig. 1, Additional file 2: Table S1). The tree showed a 100% bootstrap support for the L. infantum strains and a 75% support for the clade including all strains of MON-1, 72, 201 zymodemes. Within this clade, the MHOM/TN/80/IPT1 strain differed from the bulk of closely related strains (bootstrap support value of 66%) (Fig. 1). This made it possible to identify the most common genotypes in Europe using a simple screening method (see below).
Fig. 1
Fig. 1

Phylogenetic tree of 23 strains based on the multilocus sequence data. The sequencing data for six genes (me, pgd, icd, gpi, g6pdh, mpi) were used to build a 3578 bp long sequence. The tree was constructed using the Maximum Likelihood method based on the GTR+I model using PhyML 3.0 software. Bootstrap values were calculated from 100 replications. Numbers below branches represent bootstrap support

Exploiting sequence polymorphisms for typing

As shown in Fig. 1, the clade including zymodemes MON-1, 72, 201 could be discriminated from all other zymodemes with the exception of the MHOM/TN/80/IPT1 strain. The sequence comparison analysis showed that this group could be discriminated by exploiting the polymorphism 390T>G in the me gene sequence (Table 3). In fact, MON-1, 72, 201 present a T in position 390 (genotype 390T), while the other zymodemes present a G (genotype 390G). Due to this observation, we developed a HRM-based assay to monitor the SNP at position 390. To this end, two internal primers were designed upstream and downstream nucleotide 390, and used for a new qPCR assay (qPCR-MEint) (Additional file 1: Figure S1a). The qPCR-MEint showed a linear correlation between the log of DNA concentration (from 2 to 2 × 10-5 ng/reaction) and Ct values, with a reaction efficiency of 90% (Fig. 2).
Fig. 2
Fig. 2

Linear correlation between the log of DNA concentration and Ct values. The qPCR-MEint curve was obtained amplifying serial dilutions of genomic DNA (from 2 to 2 × 10-5 ng/reaction tube) purified from L. infantum MHOM/FR/78/LEM75 (y = -3.59x + 20.58). Each reaction was performed in triplicate. Reaction efficiency = 90%, R2 = 0.996

HRM analysis allowed us to distinguish amplicons with genotype 390G (i.e. MHOM/TN/80/IPT1 and MHOM/DZ/82/LIPA59 strains) from amplicons with genotype 390T (i.e. MHOM/FR/78/LEM75 and MHOM/IT/86/ISS218 strains) (Fig. 3a). Furthermore, using the PCR product from strains MHOM/DZ/82/LIPA59 and MHOM/FR/78/LEM75 as reference, two L. infantum clinical isolates (isolate 1 and 2) [32] were typed with qPCR-MEint followed by HRM analysis. The HRM analysis tool of Rotor-Gene 6000 software allowed for the assignment of amplicons of clinical isolate 1 and 2 to genotype 390G and genotype 390T, respectively, with a confidence > 95% in at least one replicate (Fig. 3b). These results have been confirmed by PCR product sequencing (Additional file 3: Figure S2).
Fig. 3
Fig. 3

HRM analysis of amplicons with genotypes 390G and 390T. a HRM profiles obtained from qPCR-MEint amplicons of strains MHOM/TN/80/IPT1 and MHOM/DZ/82/LIPA59 (genotype 390G) and amplicons of strains MHOM/FR/78/LEM75 and MHOM/IT/86/ISS218 (genotype 390T). b The analysis of HRM profiles allowed the assignation of amplicons of clinical isolates 1 and 2 to genotypes 390G and 390T, respectively, with a confidence > 95% in at least one replicate. Strains MHOM/DZ/82/LIPA59 (genotype 390G) and MHOM/FR/78/LEM75 (genotype 390T) were used as reference. Analyses were performed in duplicates

Application of HRM analysis in clinical samples

To test the feasibility of the HRM-based typing approach without parasite cultivation, the qPCR-MEint followed by HRM analysis was performed using DNA extracted from canine clinical samples [31, 33] and a human clinical sample (blood), using PCR product from strains MHOM/DZ/82/LIPA59 and MHOM/FR/78/LEM75 as reference. The human peripheral venous blood sample was obtained during routine diagnosis of a patient with VL by venipuncture of the upper limb. The HRM analysis allowed for the assignment of all samples to group 390T (Table 9). The results were confirmed by PCR product sequencing (Additional file 4: Figure S3).
Table 9

HRM analysis results of clinical samples

Name

Genotype

Confidence %

MHOM/FR/78/LEM75

390T

98.02

MHOM/FR/78/LEM75

390T

98.02

MHOM/DZ/82/LIPA59

390G

99.90

MHOM/DZ/82/LIPA59

390G

99.90

62 bc

390T

85.05

62 bc

390T

82.99

77 sx

390T

79.40

77 sx

390T

94.41

vea bm

390T

97.69

vea bm

390T

97.38

Psalb

390T

86.23

Psalb

390T

77.97

Abbreviations: 62 bc, canine sample, buffy coat; 77 sx, canine sample, conjunctival swab; vea bm, canine sample, bone marrow; psalb, human sample, blood

Discussion

Epidemiological studies examining the dynamic balance between host, vector, and pathogen populations is an important aspect of Leishmania infections, and the importance of reservoirs alternative to the canine population (e.g. lagomorphs, wolves) is currently being investigated [34, 35]. For example, in Italy, L. infantum zymodemes retrieved in infected dogs are primarily represented by MON-1 and MON-72, while infection in humans is caused by a more heterogeneous zymodeme population, suggesting that the canine population is not the only reservoir for all L. infantum zymodemes [15].

In this study, we investigated the genetic diversity within seven L. infantum genes, aiming to provide information that could aid in the development of tools for fast genetic characterization and epidemiological screening of L. infantum in mammalian host and/or vectors. In particular, we investigated whether it was possible to distinguish the genotype associated with the most common zymodemes in the Mediterranean area (i.e. MON-1 and MON-72), from the genotype associated with all other zymodemes, therefore limiting the number of samples needing costly and time-consuming characterizations. To this end, we collected and aligned all L. infantum gene sequences of seven enzymes (me, pgd, icd, gpi, g6pdh, mpi, pgm) available in GenBank to identify the regions that were more polymorphic. These regions were amplified in 11 other L. infantum strains available in our laboratory to increase the number of sequences to compare. The phylogenetic analysis of the concatenated sequences showed that the group including zymodemes MON-1, 72, 201 clustered separately. Zymodeme MON-201 has been found only in some HIV-positive individuals [12, 36] and in one case of feline leishmaniasis [37]; therefore, its retrieval may be considered rare. Notably, the genetic distance of MON-81 and MON-267 from other L. infantum zymodemes was confirmed (Fig. 1, Additional file 2: Table S1). In fact, MON-81 and MON-267, initially considered L. infantum, have been successively assigned to L. donovani [18].

Remarkably, the silent polymorphism at position 390 (T/G) of the me gene distinguishes strains of MON-1, 72, 201 (genotype 390T) from strains of other zymodemes (genotype 390G) (Table 3). This could be important for epidemiological applications, as MON-1 is the most common zymodeme of L. infantum in Europe. The only exception was the reference strain MHOM/TN/80/IPT1, which presents a guanine at nucleotide 390. This may be due to the geographical origin of this strain (Tunisia) compared to the European strains/isolates. It is also noteworthy that, among the MON-1 strains, only strain MHOM/TN/80/IPT1 cannot be distinguished from the MON-98 strains (considering that only me sequences were available for this MON) (Table 3). This could be in agreement with results reported by Haralambous et al. [24], which showed that some MON-1 and MON-98 zymodemes were not distinguished with a PCR-based typing method using the K26 antigen-coding gene as target sequence. Notably, the use of a real-time PCR-based assay with internal primers followed by HRM analysis allowed for the quick differentiation of sequences with the polymorphysm 390T>G not only in L. infantum isolates/strains, but also in clinical samples, enabling the potential application of this approach in population screening without parasite isolation and culturing.

Many marker sequences can be taken into consideration for genotyping purposes. The most suitable marker sequence depends on the level of resolution needed: highly variable markers can distinguish closely related genotypes but may not faithfully represent more distant relationships, while moderately variable markers will not be able to evidence the differences between closely related samples. The assay that we propose would not be able to distinguish closely related genotypes; therefore, it could be used to differentiate between relapse and re-infection only in cases where different 390T/G genotypes were found. However, it could be useful for epidemiological screening in regions where MLEE data are available, to rapidly identify zymodemes different from MON-1, 72 or 201 (e.g. for rapid screening of L. infantum genotypes in mammalian hosts). Once attributed a genotype (390T or 390G), other tests (e.g. MLEE or MLST) can be performed, depending on the level of resolution needed and on the classification system with which the results are to be compared.

Other zymodemes (i.e. MON-24, MON-78 and MON-199) could be identified by exploiting the unique SNP found across the seven gene sequences. In particular MON-24, which is another common zymodeme [12, 38], could be differentiated by exploiting the polymorphisms 204T>C in the icd gene (Table 5) by using a HRM-based assay similar to the assay described here.

A possible limitation of this study is the unavailability of some zymodeme sequences in the database. Moreover, in many cases, only one strain with sequence information per zymodeme was available. This is important to keep in mind, since strains of the same zymodeme could present different genotypes (e.g. MON-29 in me, icd and g6pdh genes) (Additional file 2: Table S1).

Conclusions

A total of 77 new sequences of seven genes encoding for metabolic enzymes in L. infantum isolates/strains have been produced and deposited in the GenBank database. The analysis of these sequences, together with sequences available in the database, allowed for the identification of genetic polymorphisms exploitable to differentiate the most common L. infantum zymodemes in the Mediterranean basin. In particular, a HRM-based assay aimed to differentiate the genotype 390T and 390G in the me gene was developed. The genotype 390T correlated with zymodemes MON-1, 72, 201, allowing for the rapid identification of the majority of L. infantum genotypes. Once a parasite is attributed to genotype 390T or 390G, other tests (e.g. MLEE, MLST or MLMT) can be performed if more detailed information is needed. This assay has been successfully applied to clinical samples, demonstrating its potential applicability in investigating the role of other mammalian hosts in epidemiological screening.

Notes

Abbreviations

qPCR: 

Quantitative real-time PCR

VL: 

Visceral leishmaniasis

CL: 

Cutaneous leishmaniasis

HRM: 

High-resolution melting

MLEE: 

Multilocus enzyme electrophoresis

MLST: 

Multilocus sequence typing

MLMT: 

Multilocus microsatellite typing

Declarations

Acknowledgements

We thank Dr Federica Bruno and Dr Germano Castelli from IZS Palermo for providing Leishmania spp. DNA. We thank Dr Emanule Gasparini and Dr Barbara Bianchi from the Santa Teresa Veterinary Clinic, Fano (PU) Italy, for providing canine clinical samples. We also thank Dr Benedetta Canovari and Professor Francesco Barchiesi from Ospedali Riuniti Marche Nord for providing a blood sample from a human VL patient, and Dr Elizabeth Tremmel for English revision.

Funding

This work was partially supported by the Italian Ministry of Health (grant number Ricerca corrente 2013 IZS SI 3/14 RC). The funder had no role in study design, data collection and analysis, interpretation of the data, or writing the manuscript.

Availability of data and materials

All data generated or analysed during this study are included in this published article and its Additional files.

Authors’ contributions

Conception and design of the study: MC and LG. Acquisition of data: MC, AD and FA. Analysis and interpretation of data: MC, LG, FV and MM. Drafting the article: MC and LG. Revising the article critically for important intellectual content: AD, FA, FV and MM. All authors read and approved the final manuscript.

Ethics approval

Approval of the study was obtained on 31st July 2012 from the Ethical Committee for Animal Experiments of the University of Urbino (CESA) [study title “Diagnosi biomolecolare della leishmaniosi attraverso l’uso di campioni clinici non invasivi e loro utilizzo per il monitoraggio terapeutico” (Prot. CESA 2/2012)].

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Biomolecular Sciences, University of Urbino “Carlo Bo”, Urbino, PU, Italy
(2)
Istituto Zooprofilattico Sperimentale of Sicily “A Mirri”, Palermo, PA, Italy

References

  1. Akhoundi M, Kuhls K, Cannet A, Votýpka J, Marty P, Delaunay P, et al. A historical overview of the classification, evolution, and dispersion of Leishmania parasites and sandflies. PLoS Negl Trop Dis. 2016;10:e0004349.View ArticleGoogle Scholar
  2. Kostygov AY, Yurchenko V. Revised classification of the subfamily Leishmaniinae (Trypanosomatidae). Folia Parasitol (Praha). 2017;64:020.Google Scholar
  3. Alvar J, Vélez ID, Bern C, Herrero M, Desjeux P, Cano J, et al. Leishmaniasis worldwide and global estimates of its incidence. PLoS One. 2012;7:e35671.View ArticleGoogle Scholar
  4. World Health Organization. Control of the leishmaniases. World Health Organ Tech Rep Ser. 2010;949:xii–xiii 1-186.Google Scholar
  5. Rioux JA, Lanotte G, Serres E, Pratlong F, Bastien P, Perieres J. Taxonomy of Leishmania. Use of isoenzymes. Suggestions for a new classification. Ann Parasitol Hum Comp. 1990;65:111–25.View ArticleGoogle Scholar
  6. Aït-Oudhia K, Harrat Z, Benikhlef R, Dedet JP, Pratlong F. Canine Leishmania infantum enzymatic polymorphism: a review including 1023 strains of the Mediterranean area, with special reference to Algeria. Acta Trop. 2011;118:80–6.View ArticleGoogle Scholar
  7. Millán J, Ferroglio E, Solano-Gallego L. Role of wildlife in the epidemiology of Leishmania infantum infection in Europe. Parasitol Res. 2014;113:2005–14.View ArticleGoogle Scholar
  8. Pratlong F, Lami P, Ravel C, Balard Y, Dereure J, Serres G, et al. Geographical distribution and epidemiological features of Old World Leishmania infantum and Leishmania donovani foci, based on the isoenzyme analysis of 2277 strains. Parasitology. 2013;140:423–34.View ArticleGoogle Scholar
  9. Kuhls K, Alam MZ, Cupolillo E, Ferreira GEM, Mauricio IL, Oddone R, et al. Comparative microsatellite typing of New World Leishmania infantum reveals low heterogeneity among populations and its recent Old World origin. PLoS Negl Trop Dis. 2011;5:e1155.View ArticleGoogle Scholar
  10. Pratlong F, Rioux J-A, Marty P, Faraut-Gambarelli F, Dereure J, Lanotte G, et al. Isoenzymatic analysis of 712 strains of Leishmania infantum in the south of France and relationship of enzymatic polymorphism to clinical and epidemiological features. J Clin Microbiol. 2004;42:4077–82.View ArticleGoogle Scholar
  11. Campino L, Pratlong F, Abranches P, Rioux J-A, Santos-Gomes G, Alves-Pires C, et al. Leishmaniasis in Portugal: enzyme polymorphism of Leishmania infantum based on the identification of 213 strains. Trop Med Int Heal. 2006;11:1708–14.View ArticleGoogle Scholar
  12. Chicharro C, Jiménez MI, Alvar J. Iso-enzymatic variability of Leishmania infantum in Spain. Ann Trop Med Parasitol. 2003;97(Suppl. 1):57–64.View ArticleGoogle Scholar
  13. Martin-Sanchez J, Gramiccia M, Di Muccio T, Ludovisi A, Morillas-Márquez F. Isoenzymatic polymorphism of Leishmania infantum in southern Spain. Trans R Soc Trop Med Hyg. 2004;98:228–32.View ArticleGoogle Scholar
  14. Alvar J, Cañavate C, Gutiérrez-Solar B, Jiménez M, Laguna F, López-Vélez R, et al. Leishmania and human immunodeficiency virus coinfection: the first 10 years. Clin Microbiol Rev. 1997;10:298–319.View ArticleGoogle Scholar
  15. Gramiccia M, Scalone A, Di Muccio T, Orsini S, Fiorentino E, Gradoni L. The burden of visceral leishmaniasis in Italy from 1982 to 2012: a retrospective analysis of the multi-annual epidemic that occurred from 1989 to 2009. Euro Surveill. 2013;18:20535.View ArticleGoogle Scholar
  16. Botilde Y, Laurent T, Quispe Tintaya W, Chicharro C, Cañavate C, Cruz I, et al. Comparison of molecular markers for strain typing of Leishmania infantum. Infect Genet Evol. 2006;6:440–6.View ArticleGoogle Scholar
  17. Cortes S, Maurício IL, Kuhls K, Nunes M, Lopes C, Marcos M, et al. Genetic diversity evaluation on Portuguese Leishmania infantum strains by multilocus microsatellite typing. Infect Genet Evol. 2014;26:20–31.View ArticleGoogle Scholar
  18. Mauricio IL, Yeo M, Baghaei M, Doto D, Pratlong F, Zemanova E, et al. Towards multilocus sequence typing of the Leishmania donovani complex: resolving genotypes and haplotypes for five polymorphic metabolic enzymes (ASAT, GPI, NH1, NH2, PGD). Int J Parasitol. 2006;36:757–69.View ArticleGoogle Scholar
  19. Zemanová E, Jirků M, Mauricio IL, Horák A, Miles MA, Lukeš J. The Leishmania donovani complex: genotypes of five metabolic enzymes (ICD, ME, MPI, G6PDH, and FH), new targets for multilocus sequence typing. Int J Parasitol. 2007;37:149–60.View ArticleGoogle Scholar
  20. El Baidouri F, Diancourt L, Berry V, Chevenet F, Pratlong F, Marty P, et al. Genetic structure and evolution of the Leishmania genus in Africa and Eurasia: what does MLSA tell us. PLoS Negl Trop Dis. 2013;7:e2255.View ArticleGoogle Scholar
  21. Schonian G, Kuhls K, Mauricio IL. Molecular approaches for a better understanding of the epidemiology and population genetics of Leishmania. Parasitology. 2011;138:405–25.View ArticleGoogle Scholar
  22. Herrera G, Hernández C, Ayala MS, Flórez C, Teherán AA, Ramírez JD. Evaluation of a Multilocus Sequence Typing (MLST) scheme for Leishmania (Viannia) braziliensis and Leishmania (Viannia) panamensis in Colombia. Parasit Vectors. 2017;10:236.View ArticleGoogle Scholar
  23. Chicharro C, Llanes-Acevedo P, García E, Nieto J, Moreno J, Cruz I. Molecular typing of Leishmania infantum isolates from a leishmaniasis outbreak in Madrid, Spain, 2009 to 2012. Euro Surveill. 2013;18:20545.View ArticleGoogle Scholar
  24. Haralambous C, Antoniou M, Pratlong F, Dedet J-PP, Soteriadou K. Development of a molecular assay specific for the Leishmania donovani complex that discriminates L. donovani/Leishmania infantum zymodemes: a useful tool for typing MON-1. Diagn Microbiol Infect Dis. 2008;60:33–42.View ArticleGoogle Scholar
  25. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012;13:134.View ArticleGoogle Scholar
  26. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41:95–8.Google Scholar
  27. Guindon S, Dufayard J-F, Lefort V, Anisimova M, Hordijk W, Gascuel O. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol. 2010;59:307–21.View ArticleGoogle Scholar
  28. Lefort V, Longueville J-E, Gascuel O. SMS: Smart Model Selection in PhyML. Mol Biol Evol. 2017;34:2422–4.View ArticleGoogle Scholar
  29. Letunic I, Bork P. Interactive tree of life (iTOL) v3: an online tool for the display and annotation of phylogenetic and other trees. Nucleic Acids Res. 2016;44:W242–5.View ArticleGoogle Scholar
  30. Ceccarelli M, Galluzzi L, Migliazzo A, Magnani M. Detection and characterization of Leishmania (Leishmania) and Leishmania (Viannia) by SYBR green-based real-time PCR and high resolution melt analysis targeting kinetoplast minicircle DNA. PLoS One. 2014;9:e88845.View ArticleGoogle Scholar
  31. Ceccarelli M, Galluzzi L, Diotallevi A, Gasparini E, Migliazzo A, Magnani M. The relevance of molecular diagnosis in a dog vaccinated against leishmaniasis. Vet Med Anim Sci. 2016;4:4.View ArticleGoogle Scholar
  32. Galluzzi L, Diotallevi A, De Santi M, Ceccarelli M, Vitale F, Brandi G, et al. Leishmania infantum induces mild unfolded protein response in infected macrophages. PLoS One. 2016;11:e0168339.View ArticleGoogle Scholar
  33. Ceccarelli M, Galluzzi L, Sisti D, Bianchi B, Magnani M. Application of qPCR in conjunctival swab samples for the evaluation of canine leishmaniasis in borderline cases or disease relapse and correlation with clinical parameters. Parasit Vectors. 2014;7:460.View ArticleGoogle Scholar
  34. Miró G, Müller A, Montoya A, Checa R, Marino V, Marino E, et al. Epidemiological role of dogs since the human leishmaniosis outbreak in Madrid. Parasit Vectors. 2017;10:209.View ArticleGoogle Scholar
  35. Oleaga A, Zanet S, Espí A, Pegoraro de Macedo MR, Gortázar C, Ferroglio E. Leishmania in wolves in northern Spain: a spreading zoonosis evidenced by wildlife sanitary surveillance. Vet Parasitol. 2018;255:26–31.View ArticleGoogle Scholar
  36. Gramiccia M. The identification and variability of the parasites causing leishmaniasis in HIV-positive patients in Italy. Ann Trop Med Parasitol. 2003;97(Suppl. 1):65–73.View ArticleGoogle Scholar
  37. Pennisi M-G, Cardoso L, Baneth G, Bourdeau P, Koutinas A, Miró G, et al. LeishVet update and recommendations on feline leishmaniosis. Parasit Vectors. 2015;8:302.View ArticleGoogle Scholar
  38. Haralambous C, Dakkak A, Pratlong F, Dedet J-P, Soteriadou K. First detection and genetic typing of Leishmania infantum MON-24 in a dog from the Moroccan Mediterranean coast: genetic diversity of MON-24. Acta Trop. 2007;103:69–79.View ArticleGoogle Scholar

Copyright

© The Author(s). 2018

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate. Please note that comments may be removed without notice if they are flagged by another user or do not comply with our community guidelines.

Advertisement