Experimental animals
Specific pathogen-free male BALB/c mice (aged 4 weeks, 16–18 g) were purchased from Qinglongshan Animal Breeding Farm, Jiangning District, Nanjing (no. 201901649). The mice were housed in a specific pathogen-free environment at a room temperature of 25 °C under a 12-h/12-h light/dark cycle. The mice were given free access to food and water. E. multilocularis protoscoleces were obtained from Mongolian gerbils preserved in our laboratory.
Cells and chemicals
Human foreskin fibroblasts (HFFs) and Reuber rat hepatoma (RH) cells were purchased from Procell (Wuhan, China). Dulbecco’s modified Eagle medium (DMEM), Medium 199 and foetal bovine serum (FBS) were obtained from Gibco (Auckland, New Zealand). Solutions containing trypsin–ethylenedinitrilotetraacetic acid, penicillin/streptomycin (100×) and gentamicin were purchased from Procell. Crocin and albendazole sulphoxide (ABZSO) were purchased from Yuanye Bio-Technology (Shanghai, China). Crocin was prepared as 10-mM stocks in double-distilled water or culture medium and stored at − 20 °C.
In vitro cultivation of E. multilocularis metacestodes
Larval material was obtained from euthanized BALB/c mice experimentally infected with homogenized larval tissue of E. multilocularis, which was originally isolated from a naturally infected plateau pika (Ochotona curzoniae) collected in Yushu, Qinghai Province, China. Molecular identification of the isolate of E. multilocularis was performed as described by Nitta et al. [19]. E. multilocularis metacestodes were prepared and cultured as previously described [20]. Briefly, the metacestodes isolated from experimentally infected BALB/c mice were crushed through a metal tea strainer and incubated overnight in phosphate-buffered saline (PBS) containing 1% penicillin/streptomycin. Then, 1 mL of metacestode tissue was cocultured with 5 × 106 RH feeder cells in DMEM containing 10% FBS and 1% penicillin/streptomycin at 37 °C and 5% CO2 with medium changes once a week. The RH cells were grown to confluence and then trypsinized and diluted 1:20 in fresh culture medium once a week. In vitro cultured metacestode vesicles were used for experiments when they reached diameters of 2–4 mm [20]. Some of the metacestode vesicles were fixed with 4% paraformaldehyde for pathological examination.
Confirmation of metacestode vesicles by real-time polymerase chain reaction
Metacestode vesicles (without host cell contamination) were detected by real-time polymerase chain reaction (RT-PCR). Total RNA was extracted from metacestode vesicles and host tissue (normal mouse livers) using an RNAsimple Kit (TianGen Biotech, Beijing, China) according to the manufacturer’s instructions. First-strand complementary DNA (cDNA) was synthesized using a FastKing gDNA Dispelling RT SuperMix Kit (TianGen Biotech). PCR was performed using specific primers for amplification of E. multilocularis glyceraldehyde-3-phosphate dehydrogenase (GAPDH) [19] and mouse GAPDH (forward, 5′-CGTGGGGCAGCCCAGAACAT-3′; reverse, 5′-GAGCAATGCCAGCCCCAGCA-3′).
RT-PCR was performed using a MasterCycler Pro S (Applied Biosystems, Foster City, CA) in a final volume of 20 μL, including 10 μL of 2 × Taq PCR MasterMix (TianGen Biotech), 0.6 μL of each primer (10 μM), 2 μL of cDNA product, and 6.8 μL of double-distilled water. Amplification was performed using the following conditions: 3 min at 94 °C followed by 30 cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s, and a final extension step at 72 °C for 3 min. The PCR products were separated by 2% agarose gel electrophoresis and stained with GeneRed (TianGen Biotech) for visualization under ultraviolet light. Metacestode germinal cells were subsequently identified in the same manner.
In vitro assessment of crocin activity against E. multilocularis metacestodes
To evaluate the efficacy of crocin against E. multilocularis metacestodes, a phosphoglucose isomerase (PGI) assay was performed in which the release of the enzyme PGI was examined upon the physical impairment of the metacestodes [20]. In brief, medium without phenol red (DMEM; 1% penicillin/streptomycin sulfate, 2 mM l-glutamine) was added to the same volume of vesicles, and then, suspended vesicles were distributed into 48-well plates (12–15 vesicles per well). Subsequently, the metacestodes were incubated for 5 days with different concentrations (0, 0.5, 1.0, 2.5, 5, 10, 20, 40, 80, 120 and 160 μM) of crocin, after which PGI release was quantified exactly as stated by Stadelmann et al. [21]. Triton X-100 (0.1% in PBS) was applied as a positive control (to induce maximal release of vesicle fluid). Each condition was tested in biological triplicate. After 5 days of incubation, 200 μL of medium supernatant was collected from each well and stored at − 20 °C until further measurements were performed. PGI measurements were performed as described previously [20], except that an Infinite M200 Pro reader (Tecan, Männedorf, Switzerland) was used to measure the increase in absorbance at 340 nm. PGI activity was calculated in Microsoft Office Excel 2010 from the linear regression of the enzyme reaction over time, and is presented as a percentage relative to the values obtained after treatment of vesicles with 0.1% Triton X-100.
Assessment of in vitro toxicity in HFFs and RH cells
An alamarBlue assay was used to assess the toxicity of crocin to confluent and preconfluent mammalian cells in vitro [22]. HFFs and RH cells were seeded into 96-well cell culture plates in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin at 37 °C and 5% CO2. To detect the growth-inhibiting effects on confluent cells, HFFs and RH cells were seeded at densities of 10,000 cells per well and 50,000 cells per well, respectively. After overnight culture, crocin was added and diluted in serial 1:10 serial dilutions down to 100 μM. To detect growth-inhibiting effects on proliferating cells, HFFs and RH cells were seeded at densities of 1000 and 5000 cells per well, respectively. Crocin was added after 6 h of cell attachment. After treatment for 5 days, cell viability was measured using an alamarBlue assay. The cells were washed three times in PBS, and resazurin was added to 10 mg/L. Fluorescence at 595 nm was measured at 0 and 4 h with an Infinite M200 Pro reader (Tecan). The values obtained at 0 h were subtracted from those obtained at 4 h. IC50 values were calculated using an online IC50 calculator (https://www.aatbio.com/tools/ic50-calculator) after logit-log transformation, and averages and SDs of six independent setups were calculated.
Assessment of in vitro toxicity in E. multilocularis germinal cells
To evaluate the activity of crocin against parasitic stem cells, germinal cells were obtained from in vitro cultured metacestode vesicles as described by Spiliotis et al., with some modifications [23]. Briefly, 20 units of cells were distributed amongst black 384-well plates. Different concentrations of crocin (0, 0.5, 1.0, 2.5, 5, 10, 20, 40, 80 and 160 μM) were added to the cells. After culture at 37 °C for 5 days under a humid nitrogen atmosphere, 25 μL of CellTiter-Glo containing 1% Triton X-100 was added. The plates were incubated at room temperature and in the dark for 15 min. After the total destruction of the cellular aggregates, luminescence was measured using an Infinite M200 Pro reader (Tecan). The values for 0 μM were set to 100% viability. IC50 values were calculated using an online IC50 calculator (https://www.aatbio.com/tools/ic50-calculator) after logit-log transformation. Four independent replicates were conducted.
Isolation of E. multilocularis protoscoleces
E. multilocularis protoscoleces were obtained from Mongolian gerbils maintained in our laboratory. Briefly, metacestode tissues were isolated from the abdominal cavities of Mongolian gerbils after euthanasia with CO2. The metacestode tissues were minced in precooled 0.9% normal saline (NS), and E. multilocularis protoscoleces were filtered using four-layer sterile gauze into a 50-mL sterile centrifuge tube. The initial filtrate was then filtered again using a 100-μm cell strainer, and the resulting filtrate was further filtered with a 40-μm cell strainer for the removal of calcareous bodies. During the filtration process, the E. multilocularis protoscoleces were constantly washed in precooled 0.9% NS. Finally, E. multilocularis protoscoleces were allowed to naturally settle to the bottom of the container and washed using precooled NS ten times. Each mouse was inoculated intraperitoneally with 3000 protoscoleces.
In vitro effects of crocin on E. multilocularis protoscoleces
Viable protoscoleces were cultured in Medium 199 (Gibco) supplemented with 1% penicillin/streptomycin, 50 μg/mL gentamicin and 4 mg/mL glucose according to a previous method [24]. Protoscoleces were transferred to 24-well cell culture plates and incubated with different thiacloprid concentrations (0, 0.5, 1.0, 2.5, 5, 10, 20, 40, 60, 80 and 160 μM). ABZSO (15 μM) was used as a positive control [25]. The protoscoleces were cultured in an incubator at 37 °C and 5% CO2 for 7 days. Protoscoleces were observed each day in triplicate with an optical microscope (BX51; Olympus, Tokyo, Japan). We determined the viability percentages by calculating the percentage of dead and live protoscoleces among 300 protoscoleces by means of an eosin exclusion experiment [26]. Live protoscoleces do not absorb eosin stain; however, in dead protoscoleces, eosin enters the cell, and the protoscoleces become red. To reduce the bias as much as possible, protoscolex viability was observed by two experimenters under double-blind conditions. Each experiment was repeated three times.
Scanning electron microscopy and transmission electron microscopy
E. multilocularis protoscoleces or metacestode vesicles were treated with crocin as described above. The protoscoleces or metacestode vesicles were fixed in 2.5% glutaraldehyde buffer (pH = 7.25) at 4 °C for 2 h. Then, the samples were postfixed in 1 mL of osmium tetroxide (2% in 0.1 M cacodylate buffer) for 2 h, washed three times in water, and dehydrated in increasing concentrations of ethanol (30%, 50%, 70%, 80%, 90%, 95% and 2× 100%). Subsequently, the samples were incubated in hexamethyl disilazine for 2 min. After evaporation at room temperature, the samples were sputter-coated with gold and inspected in a Hitachi SU8100 or SU8020 scanning electron microscope operating at 3.0 kV. For transmission electron microscopy (TEM) analysis, dehydrated samples were embedded in Epon 812 resin with three subsequent resin changes for 2 days and incubated at 65 °C overnight for polymerization. Sections (50 nm) were prepared using an ultramicrotome (Leica, Wetzlar, Germany) and loaded onto Formvar carbon-coated nickel grids (Gilder Grids, Grantham, Lincolnshire, UK). Finally, the samples were stained with uranium acetate and lead citrate and observed using a JEM-1400plus transmission electron microscope (JEOL, Tokyo, Japan).
Determination of the in vivo toxicity of crocin
To assess the subacute toxicity of crocin in vivo, mice were randomly assigned to the control group (orally administered NS, n = 6), the group orally administered crocin at 50 mg/kg (n = 6) and the group orally administered crocin at 100 mg/kg (n = 6). The treatment was conducted for 6 weeks. At the end of the experiment, blood samples were collected from the eyeballs of mice under anaesthesia before euthanasia and preserved in ethylenedinitrilotetraacetic acid-K2 anticoagulant tubes for white blood cell, haemoglobin and platelet analysis. For assessment of biochemical indicators, the blood samples were incubated in anticoagulant-free tubes at 37 °C for 1 h and then centrifuged at 3500 r.p.m. for 10 min. The isolated serum samples were used to detect the relative levels of alanine aminotransferase, aspartate aminotransferase, total bilirubin, direct bilirubin, indirect bilirubin, total protein, albumin, alkaline phosphatase, creatinine and blood urea nitrogen. Subsequently, the mice were sacrificed, and their livers and kidneys were harvested, fixed in 4% paraformaldehyde, prepared for haematoxylin–eosin (HE) staining and observed under a BX51 microscope (Olympus).
Determination of the in vivo effects of crocin on E. multilocularis metacestodes
BALB/c mice were infected with E. multilocularis protoscoleces for 8 weeks. Later, the mice were randomly distributed into four groups as follows: the control group (orally administered 0.4 mL of NS, n = 10); the ABZ group (orally administered 200 mg/kg ABZ dissolved in 0.4 mL of NS, n = 10); the crocin50 group (orally administered 50 μg/mL crocin dissolved in 0.4 mL of NS, n = 10); and the crocin100 group (orally administered 100 μg/mL crocin dissolved in 0.4 mL of NS, n = 10). Uninfected mice were used as a blank group. Drug administration was performed once a day at a fixed time point. After 6 weeks of treatment, blood samples were collected from the eyeballs before CO2 euthanasia. Blood samples were incubated at 37 °C for 1 h and centrifuged at 3500 r.p.m. for 10 min at 4 °C. The serum was harvested and stored at − 20 °C for interleukin (IL)-2, IL-4 and immunoglobulin E (IgE) detection. In addition, metacestodes in the abdominal cavity were carefully harvested and weighed. The host tissue surrounding the metacestode was isolated under a stereomicroscope (SZ51; Olympus) and stored at -80 °C for further experiments. Some metacestode tissues were fixed in 4% paraformaldehyde for pathological examinations, and some were used for TEM analysis after fixation in 2.5% glutaraldehyde buffer and staining.
HE staining
Tissues from experimental animals were washed in PBS and fixed in 4% paraformaldehyde at room temperature for 36 h. The next day, the samples were dehydrated, embedded, and sliced into 5-μm sections. After dewaxing and dehydration, the sections were stained with haematoxylin for 2–5 min and with eosin for 15 s. The sections were sealed with neutral gum and observed under a light microscope (BX51; Olympus).
Periodic acid Schiff and Masson trichrome staining
Metacestode tissues were fixed in paraformaldehyde, embedded in paraffin, sectioned at 5 μm, and stained with periodic acid Schiff (PAS; Solarbio, Beijing, China) and Masson trichrome (Solarbio) according to the instructions for evaluation of fibrosis and the extent of extracellular matrix deposition in host tissues around metacestodes. PAS-positive substances appear red or purplish red. The collagen fibres were blue or green after Masson trichrome staining. The sections were finally observed under a microscope (BX51; Olympus).
Enzyme-linked immunosorbent assay
The serum levels of IL-2, IL-4 and IgE in experimental animals were calculated against standard curves using commercial enzyme-linked immunosorbent assay (ELISA) kits (Elabscience Biotechnology, Wuhan, China). The optical density value at 450 nm was read with an Infinite M200 Pro enzyme reader (Tecan), and the concentration was calculated.
Real-time quantitative PCR
Total RNA was isolated from host tissues around the metacestodes using TRIzol (Thermo Scientific, Waltham, MA), and the integrity of the RNA was assessed by examination of the 18S and 28S fragments of ribosomal RNA following agarose gel electrophoresis. Later, the RNA purity and concentration were determined using a NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE). Qualified RNA (2 μg) was reverse-transcribed into cDNA using FastKing gDNA Dispelling RT SuperMix (TianGen Biotech), which was sub-packaged and preserved at -80 °C for use. The primer sequences were as follows: MMP2, forward 5′‐TTGGGCTGCCCCAGACAGGT‐3′, reverse 5′‐GTCCCACTTGGGCTTGCGGG‐3′; MMP9, forward 5′‐AGCCCCTGCTCCTGGCTCTC‐3′, reverse 5′‐CTGCCAGCTGGGTGTCCGTG‐3′; collagen I, forward 5′‐TGGCCAGATGGGTCCCCGAG‐3′, reverse 5′‐AGGGGGTCCAGCAGCACCAA‐3′; collagen III, forward 5′‐ACCTGCAGGACCCACTGGCA‐3′, reverse 5′‐GACCACGCCCACCGGGAAAG‐3′; and RPS18, forward 5′‐GCCAGGTTCTGGCCAACGGT‐3′, reverse 5′‐CCCTGCGGCCAGTGGTCTTG‐3′. The reaction buffers for RT-qPCR were prepared using a commercial kit (TianGen Biotech), and RT-qPCR was conducted using an ABI Q5 RT-qPCR system (Applied Biosystems). The PCR thermal cycling protocol applied consisted of one step of 2 min at 50 °C for pretreatment and one step of 10 min at 95 °C for initial denaturation followed by 40 cycles consisting of a denaturation step for 15 s at 95 °C and an annealing step/extension step for 30 s at 60 °C. A melting curve analysis was performed after the final amplification period with a temperature gradient of 95 °C for 15 s, 60 °C for 15 s, and 95 °C for 15 s. The relative messenger RNA (mRNA) levels were calculated using the 2−△△CT method [27].
Western blotting analysis
Host tissues from around metacestodes were lysed on ice using radioimmunoprecipitation assay buffer (Thermo Scientific) containing phenylmethylsulfonyl fluoride, and the lysates were centrifuged at 4 °C and 12,000 r.p.m. for 10 min. The supernatant was collected, diluted in 5× loading buffer and boiled in a 95 °C water bath for 10 min. The prepared protein samples were preserved at − 80 °C after measurement of the protein concentration. The protein samples were subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis at 20 μg per lane and transferred to 0.2-μm polyvinylidene fluoride membranes (Merck Millipore, Darmstadt, Germany). Nonspecific antigens on the membrane were blocked with Tris-buffered saline 0.05%—Tween 20 containing 5% nonfat milk at room temperature for 1 h. The polyvinylidene fluoride membranes were subjected to immunoblotting with primary antibodies against MMP2 (1:1000; Abclonal, Wuhan, China), MMP9 (1:1000; Abclonal) and β-actin (1:1000; Abclonal) at 4 °C overnight. The next day, they were washed and incubated with horseradish peroxidase-labelled goat anti-rabbit IgG (1:5000) at room temperature for 1 h. After washing, an enhanced chemiluminescence (Thermo Scientific) method was used to expose the bands, and the greyscale values were normalized to that of β-actin.
Statistical analysis
The data are expressed as the mean ± SD and were plotted with GraphPad Prism 8.0 software. Multiple comparisons between more than two groups were analysed using one-way ANOVA or the Kruskal–Wallis test (nonparametric). Median inhibitory concentrations (IC50) and median effective concentrations (EC50) were calculated using an online half-max graphing calculator (https://www.aatbio.com/index.html). A value of P < 0.05 was considered significant.